View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11438_low_23 (Length: 282)
Name: NF11438_low_23
Description: NF11438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11438_low_23 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 17 - 263
Target Start/End: Complemental strand, 2491504 - 2491255
Alignment:
| Q |
17 |
aacctgtgttacaaggtgcttacattaagcaatatattctacatacatatcagatgcaaaagaaacataagacaaattgaattaggaaaggaaccccgga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2491504 |
aacctgtgttacaaggtgcttacattaagcaatatattctacatacatatcagatgcaaaagaaacataagacaaattgaattaggaaaggaaccccgga |
2491405 |
T |
 |
| Q |
117 |
tatgcgacctagttcagagacataaaatgctaagagcaattcccattgggaatttctgtgtttttaag---cttaactaactgttatttgttgtgtttcg |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
2491404 |
tatgcgacctagttcagagacataaaatgctaagagcaattcccattgggagtttctgtgtttttaagcttcttaactaactgttatttgttgtgtttcg |
2491305 |
T |
 |
| Q |
214 |
ccattggaacatgtttatgtggtagacatgattgtttaaagctgcctttg |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2491304 |
ccattggaacatgtttatgtggtagacatgattgtttaaagctgcctttg |
2491255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University