View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11438_low_31 (Length: 217)
Name: NF11438_low_31
Description: NF11438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11438_low_31 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 12 - 198
Target Start/End: Complemental strand, 2491444 - 2491255
Alignment:
| Q |
12 |
agaagcataggacaaattgaattaggaaaggaaccccggatatgcgacctagttcagagacataaaatgctaagagcaattcccattgggaatttctgtg |
111 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
2491444 |
agaaacataagacaaattgaattaggaaaggaaccccggatatgcgacctagttcagagacataaaatgctaagagcaattcccattgggagtttctgtg |
2491345 |
T |
|
| Q |
112 |
tttttaag---cttaactaactgttatttgttgtgtttcgccattggaacatgtttatgtggtagacatgattgtttaaagctgcctttg |
198 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2491344 |
tttttaagcttcttaactaactgttatttgttgtgtttcgccattggaacatgtttatgtggtagacatgattgtttaaagctgcctttg |
2491255 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University