View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11439_high_8 (Length: 213)
Name: NF11439_high_8
Description: NF11439
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11439_high_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 29 - 200
Target Start/End: Original strand, 36357284 - 36357455
Alignment:
| Q |
29 |
tatatgcatgaaatccagatgaaaaatcatgacacatataaatacttgaagaaatgttacataaacttcaatgtgacaggtataattgtaccaaatttta |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36357284 |
tatatgcatgaaatccagatgaaaaatcatgacacatataaatacttgaagaaatgttacataaacttcaatgtgacaggtataattgtaccaaatttta |
36357383 |
T |
 |
| Q |
129 |
gataaatataattgaattaaaagagcttgacattataccaactgttttccagtctcattgcggatctctgct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
36357384 |
gataaatataattgaattaaaagagcttgacattataccaactgtgttccagtctcattgcggatccctgct |
36357455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University