View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11439_low_6 (Length: 419)
Name: NF11439_low_6
Description: NF11439
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11439_low_6 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 341; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 341; E-Value: 0
Query Start/End: Original strand, 18 - 409
Target Start/End: Complemental strand, 15097096 - 15096702
Alignment:
| Q |
18 |
attgctcccttatagcagttctttttcatgtgcctttgaattacttcttggttatggtgatgcaatttggagtaccgggcgtggcgatggcgtccgtgtt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
15097096 |
attgctcccttatagcagttctttttcatgtgcctttgaattatttcttggttatggtgatgcaatttggtgtaccgggcgtggcgatggcgtccgtgtt |
15096997 |
T |
|
| Q |
118 |
aacgaatatgaacatggttgtattgatggcggggtatgtcggcttgtttaggaagaaggagatgatgttaaagtggcccggctg---cggcggtggcgga |
214 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||||||| ||||||||||||||||||||||||||||| ||||| || || ||||||||||||| |
|
|
| T |
15096996 |
aacgaatatgaacatggtcgtgttgatggcggggtatgtcgggttgtttaggaagaaggagatgatgttaaaatggccgggttgtggcggcggtggcgga |
15096897 |
T |
|
| Q |
215 |
gggatgatggttgtgagtgaaggtttgggggagttgatgaaattggctgtacctagttgtcttatgatatgtttggaatggtggtggtatgagattgtta |
314 |
Q |
| |
|
||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15096896 |
gggatgatggtggttagtgaaggtttgggggagttgatgaaattggctgtacctagttgtcttatgatatgtttggaatggtggtggtatgagattgtta |
15096797 |
T |
|
| Q |
315 |
ctgttttggctggttatttggagaatcctacattggctgttgctgctactgggattttgattcagacaactagtatgatgtatactgtccctatg |
409 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15096796 |
ctgttttggctggttatttggagaatcctacattggctgttgctgctactgggattttgattcagacaactagtatgatgtatactgtccctatg |
15096702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University