View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1143_low_16 (Length: 246)
Name: NF1143_low_16
Description: NF1143
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1143_low_16 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 207
Target Start/End: Original strand, 47096119 - 47096325
Alignment:
| Q |
1 |
tgcagtaaggaagtgatgaatgattgtttctgcatggctgctgttttgattgactcagtttgttataagaaaaggacacctcttttaaatgcaagaataa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47096119 |
tgcagtaaggaagtgatgaatgattgtttctgcatggctgctgttttgattgactcagtttgttataagaaaaggacacctcttttaaatgcaagaataa |
47096218 |
T |
 |
| Q |
101 |
gtatacctgaaactagcaatagagtgacactgattaaagttcctcaaattcttcaagaggatcaaaatgattcaccttctcgagtcgttttgatcgtagc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47096219 |
gtatacctgaaactagcaatagagtgacactgattaaagttcctcaaattcttcaagaggatcaaaatgattcaccttctcgagtcgttttgatcgtagc |
47096318 |
T |
 |
| Q |
201 |
cgcatca |
207 |
Q |
| |
|
||||||| |
|
|
| T |
47096319 |
cgcatca |
47096325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 211 - 246
Target Start/End: Complemental strand, 5897907 - 5897872
Alignment:
| Q |
211 |
taattatgcccaatacaaaatcctaatatgttatca |
246 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| |
|
|
| T |
5897907 |
taattacgcccaatacaaaatcctaatatgttatca |
5897872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University