View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11441_high_7 (Length: 241)
Name: NF11441_high_7
Description: NF11441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11441_high_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 11402610 - 11402383
Alignment:
| Q |
1 |
tgcaaattctcaatctttattgaaattaatcatatgaactttatttatattttaaatatttgttgaaatttaaaaatatgagtgaact-aacacttgcta |
99 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
11402610 |
tgcaaattctcaatctttgttgaaattaatcatatgaactttatttatattttaaatatttgttgaaatttaaaaatatgagtgaacttaacacttgcta |
11402511 |
T |
 |
| Q |
100 |
gttatttaaaaataagatggtatatttttattatgatcttgaaaatagttgatgcactttttccataaccaaatttgcttcttctgttggac-tgcaact |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||| || |||| |
|
|
| T |
11402510 |
gttatttaaaaataagatggtatatttttattatgatcttgaaaatagttgatgcactttttccataacaaaatttgcttctgctgttggacttgtaact |
11402411 |
T |
 |
| Q |
199 |
tatatttcatgatggtgtagggaaagtt |
226 |
Q |
| |
|
|||| || | |||||||||||||||||| |
|
|
| T |
11402410 |
tatagtttacgatggtgtagggaaagtt |
11402383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University