View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11441_low_9 (Length: 239)
Name: NF11441_low_9
Description: NF11441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11441_low_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 11 - 200
Target Start/End: Complemental strand, 5741614 - 5741426
Alignment:
| Q |
11 |
gtgtactaggcaggcaactagcaagcttctttataactcatcagtaaacaaaacccacgtgtacttagacattttatctaaacacaccacgtactcaaac |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5741614 |
gtgtactaggcaggcaactagcaagcttctttataactcatcagtaaacaaaatccacgtgtacttagacattttatctaaacacaccacgtactcaaac |
5741515 |
T |
 |
| Q |
111 |
tttgaagtatatattgcaaaatcgttttcaacagcatttacatctcttttagcaccaattaaattactttcatcttattgactatggcaa |
200 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5741514 |
tttgaagtatatattgcaaaatcg-tttcaacagcatttacatctcttttagcaccaattaaattactttcatcttattgactatggcaa |
5741426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University