View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11442_low_4 (Length: 250)
Name: NF11442_low_4
Description: NF11442
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11442_low_4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 116; Significance: 4e-59; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 19 - 138
Target Start/End: Complemental strand, 11019259 - 11019140
Alignment:
| Q |
19 |
aaaatgtcatagagctcacaccaataaatcagatcagattgatatataaaggtaacagagaaaagtttacattagcaacataattaaaaatgcaaggttt |
118 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11019259 |
aaaatgtcatagagctcacaccgataaatcagatcagattgatatataaaggtaacagagaaaagtttacattagcaacataattaaaaatgcaaggttt |
11019160 |
T |
|
| Q |
119 |
gtaacatgttcagtgtgaca |
138 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
11019159 |
gtaacatgttcagtgtgaca |
11019140 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 135 - 242
Target Start/End: Complemental strand, 11018966 - 11018859
Alignment:
| Q |
135 |
gacaattttactctccgctcttctcttttccactcttgttgaacgtcgttctcaacttcatccttctattttcttccaatgtttttcattttgttcgatt |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||| || | |||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
11018966 |
gacaattttactctccgctcttctcttttccactctcgttgaatgttgctctcaacttcatccttctattttcttccaatgtttttcatttcgttcgatt |
11018867 |
T |
|
| Q |
235 |
ttcttctc |
242 |
Q |
| |
|
|||||||| |
|
|
| T |
11018866 |
ttcttctc |
11018859 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University