View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11443_high_3 (Length: 263)
Name: NF11443_high_3
Description: NF11443
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11443_high_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 15 - 256
Target Start/End: Complemental strand, 36095846 - 36095605
Alignment:
| Q |
15 |
acatagttcttcaattaatgagtaaattcttaactttaccttgtcaagtgcacccttcactttagaggagttagattttatcactatattttgatgttgt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36095846 |
acatagttcttcaattaatgagtaaattcttaactttaccttgtcaagtgcacccttcactttagaggagttagattttatcactatattttgatgttgt |
36095747 |
T |
 |
| Q |
115 |
tcatgcttgatatgtatgtgaaatttttctttagacccttttgtgttttggtatttataagtttagtgaactgaatgatataagttgtggcctggtttgg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
36095746 |
tcatgcttgatatgtatgtgaaatttttctttagacccttttgtgttttggtatttataagtttagtgaactgaatgatatatgttgtggcctggtttgg |
36095647 |
T |
 |
| Q |
215 |
aagttcagtagtagtattttggtctttggtgttaatcctttg |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36095646 |
aagttcagtagtagtattttggtctttggtgttaatcctttg |
36095605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University