View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11444_high_1 (Length: 553)
Name: NF11444_high_1
Description: NF11444
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11444_high_1 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 292; Significance: 1e-164; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 33 - 380
Target Start/End: Complemental strand, 34675366 - 34675014
Alignment:
| Q |
33 |
gtgagggaggagttcgttgaggatctttgtgacgttgcttgcgccgaagatcttgtgaacgtttgcaaatttttgaggttcttccggtggaaagtatggt |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34675366 |
gtgagggaggagttcgttgaggatctttgtgacgttgcttgcgccgaagatcttgtgaacgtttgcaaatttttgaggttcttccggtggaaagtatggt |
34675267 |
T |
|
| Q |
133 |
gcaaagatgcagcctggcatgcattttcgacgaaggaatttgcaggctgcacatggtgaattgtatgagcttgatgatgccattttttctcctgcgctac |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34675266 |
gcaaagatgcagcctggcatgcattttcgacgaaggaatttgcaggctgcacatggtgaattgtatgagcttgatgatgccattttttctcctgcgctac |
34675167 |
T |
|
| Q |
233 |
aaagcaat-nnnnnnntattgagtcatacaaaatatgaatctatttatcttctaactttcccttc--tacatcgtgttttcaagtaataatcagttttag |
329 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
34675166 |
aaagcaataaaaaaaatattgagtcatacaaaatatgaatctatttatcttctaactttcccttctatacatcgtgttttcaagtaataatcag-tttag |
34675068 |
T |
|
| Q |
330 |
tttcaaaagttattacaaaactcaatggtcacaaata---aatatcagatctaa |
380 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
34675067 |
tttcaaaagttattacaaaactcaatggtcacaaataaagaatatcagatctaa |
34675014 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 80; Significance: 3e-37; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 80; E-Value: 3e-37
Query Start/End: Original strand, 33 - 219
Target Start/End: Complemental strand, 43583355 - 43583166
Alignment:
| Q |
33 |
gtgagggaggagttcgttgaggatctttgtgacgttgcttgcgccgaagatcttgtgaacgtttgcaaatttttgaggttcttccggtggaaagtatggt |
132 |
Q |
| |
|
||||||||| ||||| ||||| | ||||||||| ||||| || || || || ||||| |||||||||||||||||||| ||||| || || ||||| ||| |
|
|
| T |
43583355 |
gtgagggagaagttcattgagaagctttgtgacattgctagcaccaaatattttgtgcacgtttgcaaatttttgaggctcttctggagggaagtaaggt |
43583256 |
T |
|
| Q |
133 |
gcaaagatgcagcctggcatgcattttcgacgaaggaatttgcaggctgcacatggtgaattgtatgagct---tgatgatgccattttt |
219 |
Q |
| |
|
||||||||||| |||||||||||||||| | | |||||||||||| ||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
43583255 |
gcaaagatgcatcctggcatgcattttctcctcaagaatttgcaggcagcacaaggtgaattgtatgagctggatgatgatgccattttt |
43583166 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 67 - 155
Target Start/End: Original strand, 12360773 - 12360861
Alignment:
| Q |
67 |
ttgcttgcgccgaagatcttgtgaacgtttgcaaatttttgaggttcttccggtggaaagtatggtgcaaagatgcagcctggcatgca |
155 |
Q |
| |
|
|||||||| || || || |||||||| |||||||||||||| |||||||| ||||| || ||||| ||||| ||||| |||||||||| |
|
|
| T |
12360773 |
ttgcttgcaccaaatattttgtgaacatttgcaaatttttgtggttcttctggtgggaaatatggagcaaatatgcaatctggcatgca |
12360861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University