View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11444_high_3 (Length: 417)
Name: NF11444_high_3
Description: NF11444
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11444_high_3 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 18 - 306
Target Start/End: Complemental strand, 33757270 - 33756982
Alignment:
| Q |
18 |
ctgtgacggtaacggaaatgactgtgacggtgacggtgatag-gattgacaatgagatggacatca-tcatgaagagagtgaaagcattaaaagtggttc |
115 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||||||||||| | |||||| || || ||| || | ||||||||||||||||||||||||||||||||| |
|
|
| T |
33757270 |
ctgtgacggtaatggaaatgactgtgactgtgacggtgattgtgattgagaa-ga-atgtttattaatcatgaagagagtgaaagcattaaaagtggttc |
33757173 |
T |
|
| Q |
116 |
gaattggtgtattggaaataacattgagaatttgaagagcttgattttctgccatcgttgcgaggagtcgtatcgttgaaggatcgagtggtagctgtga |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||| |
|
|
| T |
33757172 |
gaattggtgtattggaaataacattgagaatttgaagagcttgattttctgccatcgttgcgaggagtcgtatcgttgaaggatcgagtggtggttgtga |
33757073 |
T |
|
| Q |
216 |
ttgtttcacgcatatttggtttattagattttctacggatgccggaagtgtcaccggtggttgctccgtcgccataactaactttcacggc |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
33757072 |
ttgtttcacgcatatttggtttattagattttctacggatgccggaagtgtcaccggtggttgctccgtcgccataacaaactttcacggc |
33756982 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University