View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11445_low_7 (Length: 237)
Name: NF11445_low_7
Description: NF11445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11445_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 38204681 - 38204457
Alignment:
| Q |
1 |
tgaaaaattagtcaaaaggaagtattannnnnnnggatttcatgatttttcaatattacatgtgtttgtcagtgaatttaaattcagtctgataccattt |
100 |
Q |
| |
|
||||||||||||||||||||||||||| ||| ||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
38204681 |
tgaaaaattagtcaaaaggaagtattatttttttggacttcatgattttccaatattacatgtgt----cagtgaatttaaattcagtctgataccattt |
38204586 |
T |
 |
| Q |
101 |
ttctttgccattcatcacctatacagtttcttatatctgatcatccgctcagtggtcacattcgggctagtttgaggacaaagagcgatcattatggatc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
38204585 |
ttctttgccattcatcacctatacagtttcttatatctgatcatccgctcagtggtcacattcgggctagtttgagaacaaagagcgatcattatggatc |
38204486 |
T |
 |
| Q |
201 |
aattcctatttctgtcattgctgtctgtg |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
38204485 |
aattcctatttctgtcattgctgtctgtg |
38204457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University