View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11446_high_1 (Length: 817)

Name: NF11446_high_1
Description: NF11446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11446_high_1
NF11446_high_1
[»] chr4 (173 HSPs)
chr4 (439-740)||(35796741-35797054)
chr4 (439-739)||(35788667-35788979)
chr4 (437-737)||(22231070-22231382)
chr4 (550-739)||(35819016-35819204)
chr4 (527-739)||(40717306-40717517)
chr4 (439-735)||(50543329-50543639)
chr4 (441-683)||(28245527-28245782)
chr4 (526-739)||(52559575-52559789)
chr4 (527-740)||(6218211-6218423)
chr4 (541-724)||(4645664-4645847)
chr4 (526-636)||(5398574-5398684)
chr4 (531-739)||(11036615-11036822)
chr4 (572-722)||(4905646-4905796)
chr4 (562-739)||(22822358-22822535)
chr4 (586-727)||(36686065-36686206)
chr4 (526-739)||(7926336-7926543)
chr4 (586-737)||(12869187-12869337)
chr4 (560-722)||(6666533-6666695)
chr4 (586-739)||(9685406-9685558)
chr4 (550-727)||(21646390-21646566)
chr4 (598-739)||(34357966-34358106)
chr4 (526-657)||(27634180-27634311)
chr4 (601-739)||(1518172-1518309)
chr4 (573-739)||(22445459-22445625)
chr4 (586-739)||(14783111-14783263)
chr4 (586-739)||(53814853-53815005)
chr4 (539-643)||(25324146-25324250)
chr4 (544-722)||(35645282-35645457)
chr4 (539-739)||(33107878-33108078)
chr4 (586-739)||(53828447-53828599)
chr4 (528-648)||(5398312-5398431)
chr4 (544-722)||(35645571-35645746)
chr4 (590-700)||(4464341-4464452)
chr4 (526-717)||(21750141-21750332)
chr4 (526-624)||(6778542-6778640)
chr4 (586-699)||(40716544-40716658)
chr4 (526-692)||(13555346-13555507)
chr4 (550-721)||(43743014-43743180)
chr4 (633-738)||(17111573-17111676)
chr4 (590-692)||(30530090-30530192)
chr4 (527-699)||(23209888-23210060)
chr4 (586-739)||(54054962-54055108)
chr4 (663-739)||(21498803-21498878)
chr4 (436-516)||(22827546-22827626)
chr4 (550-739)||(31944929-31945118)
chr4 (441-516)||(21498803-21498878)
chr4 (590-771)||(24513287-24513468)
chr4 (441-516)||(53814930-53815005)
chr4 (661-739)||(22231072-22231149)
chr4 (661-739)||(22827546-22827623)
chr4 (661-739)||(22845446-22845523)
chr4 (661-739)||(22863482-22863559)
chr4 (439-516)||(1518172-1518249)
chr4 (671-728)||(5398221-5398278)
chr4 (654-739)||(21498362-21498446)
chr4 (439-516)||(22845446-22845523)
chr4 (439-516)||(22863482-22863559)
chr4 (562-722)||(41853398-41853559)
chr4 (654-735)||(50543322-50543402)
chr4 (663-739)||(9685640-9685715)
chr4 (663-739)||(28245527-28245602)
chr4 (663-739)||(53814675-53814750)
chr4 (441-516)||(9685640-9685715)
chr4 (441-516)||(21498362-21498437)
chr4 (441-516)||(25052860-25052935)
chr4 (550-643)||(12005594-12005690)
chr4 (438-516)||(39902561-39902639)
chr4 (661-739)||(39902562-39902639)
chr4 (439-516)||(12869028-12869105)
chr4 (586-722)||(18528375-18528517)
chr4 (654-739)||(25052860-25052944)
chr4 (654-739)||(35609703-35609787)
chr4 (439-516)||(40717440-40717517)
chr4 (439-516)||(52559575-52559652)
chr4 (658-722)||(5398472-5398536)
chr4 (432-516)||(16066073-16066157)
chr4 (663-739)||(20821981-20822056)
chr4 (612-739)||(5846154-5846280)
chr4 (461-516)||(6666221-6666276)
chr4 (441-516)||(20821981-20822056)
chr4 (465-516)||(28246110-28246161)
chr4 (594-704)||(30565965-30566076)
chr4 (659-734)||(40726734-40726808)
chr4 (461-516)||(53828310-53828365)
chr4 (683-737)||(2261774-2261827)
chr4 (672-722)||(11053891-11053941)
chr4 (553-611)||(20726728-20726786)
chr4 (661-739)||(53828288-53828365)
chr4 (459-516)||(400584-400641)
chr4 (453-514)||(2261766-2261827)
chr4 (439-516)||(5398475-5398551)
chr4 (439-516)||(18528216-18528293)
chr4 (463-516)||(35609513-35609566)
chr4 (463-516)||(35609734-35609787)
chr4 (659-720)||(36685872-36685933)
chr4 (661-722)||(53559289-53559350)
chr4 (439-516)||(53828522-53828599)
chr4 (557-621)||(1215880-1215944)
chr4 (612-722)||(8902651-8902762)
chr4 (601-697)||(9908770-9908866)
chr4 (559-635)||(13495588-13495664)
chr4 (663-739)||(16066073-16066148)
chr4 (464-516)||(27464272-27464324)
chr4 (663-739)||(54054806-54054881)
chr4 (461-512)||(2463818-2463869)
chr4 (461-516)||(5398233-5398287)
chr4 (461-516)||(5846154-5846209)
chr4 (572-627)||(7572617-7572672)
chr4 (461-516)||(9279235-9279290)
chr4 (441-516)||(9685406-9685481)
chr4 (461-516)||(11036767-11036822)
chr4 (439-514)||(12869262-12869337)
chr4 (441-516)||(14783188-14783263)
chr4 (437-516)||(25323795-25323874)
chr4 (579-665)||(26549504-26549591)
chr4 (676-739)||(35645779-35645841)
chr4 (654-737)||(37836090-37836172)
chr4 (461-516)||(44118880-44118935)
chr4 (441-516)||(53814675-53814750)
chr4 (441-516)||(54054806-54054881)
chr4 (439-509)||(6666634-6666704)
chr4 (461-511)||(12005490-12005540)
chr4 (661-739)||(12869028-12869105)
chr4 (670-740)||(13495473-13495543)
chr4 (566-700)||(25323937-25324071)
chr4 (539-621)||(33107759-33107841)
chr4 (661-739)||(35609489-35609566)
chr4 (439-509)||(53559289-53559359)
chr4 (674-739)||(9279235-9279299)
chr4 (661-726)||(20095312-20095377)
chr4 (439-516)||(21685006-21685083)
chr4 (439-516)||(22822358-22822435)
chr4 (661-718)||(28073180-28073237)
chr4 (581-722)||(32002347-32002487)
chr4 (461-514)||(37836090-37836143)
chr4 (663-735)||(2463818-2463889)
chr4 (461-517)||(6218211-6218267)
chr4 (659-739)||(11036508-11036587)
chr4 (459-503)||(11053900-11053944)
chr4 (439-515)||(17111573-17111648)
chr4 (661-721)||(21685023-21685083)
chr4 (515-603)||(24974250-24974338)
chr4 (472-516)||(31254439-31254483)
chr4 (439-511)||(40726734-40726806)
chr4 (663-711)||(42786473-42786521)
chr4 (661-725)||(43743240-43743304)
chr4 (461-517)||(53699034-53699090)
chr4 (473-516)||(5846387-5846430)
chr4 (661-700)||(7926604-7926643)
chr4 (461-516)||(11036532-11036587)
chr4 (461-516)||(11783813-11783868)
chr4 (660-739)||(18528215-18528293)
chr4 (663-722)||(24513140-24513199)
chr4 (473-516)||(27634114-27634157)
chr4 (461-516)||(34358051-34358106)
chr4 (461-516)||(35645786-35645841)
chr4 (579-701)||(42842159-42842282)
chr4 (662-709)||(45784870-45784917)
chr4 (659-701)||(2516244-2516286)
chr4 (438-516)||(6218447-6218525)
chr4 (661-739)||(6218447-6218524)
chr4 (586-664)||(6666743-6666821)
chr4 (473-515)||(17222685-17222727)
chr4 (661-739)||(44118858-44118935)
chr4 (591-696)||(50870627-50870733)
chr4 (682-739)||(6666220-6666276)
chr4 (467-516)||(7892556-7892605)
chr4 (670-739)||(12005477-12005545)
chr4 (461-514)||(21750063-21750116)
chr4 (439-516)||(35819127-35819204)
chr4 (661-722)||(41187931-41187992)
chr4 (654-699)||(52827417-52827462)
chr4 (471-516)||(54055064-54055108)
[»] chr1 (162 HSPs)
chr1 (437-736)||(26176919-26177230)
chr1 (439-722)||(35772053-35772349)
chr1 (526-739)||(4112870-4113082)
chr1 (552-739)||(39348242-39348428)
chr1 (526-721)||(2859491-2859686)
chr1 (574-740)||(30369842-30370007)
chr1 (439-739)||(38733160-38733467)
chr1 (526-722)||(25145584-25145780)
chr1 (526-724)||(27413369-27413567)
chr1 (562-731)||(33156748-33156918)
chr1 (521-739)||(38668133-38668350)
chr1 (526-739)||(16162941-16163152)
chr1 (550-739)||(4098291-4098478)
chr1 (573-709)||(51460353-51460489)
chr1 (461-699)||(35892103-35892354)
chr1 (526-739)||(7307729-7307941)
chr1 (526-648)||(25713256-25713378)
chr1 (453-657)||(52961436-52961653)
chr1 (526-668)||(4112639-4112781)
chr1 (586-739)||(51589000-51589152)
chr1 (550-701)||(26173344-26173495)
chr1 (586-739)||(51589814-51589966)
chr1 (586-739)||(3169774-3169926)
chr1 (538-701)||(31496247-31496410)
chr1 (516-740)||(9499253-9499475)
chr1 (526-700)||(8870788-8870948)
chr1 (522-722)||(7653265-7653465)
chr1 (550-721)||(12376561-12376732)
chr1 (604-739)||(32783223-32783357)
chr1 (544-646)||(17208654-17208756)
chr1 (661-739)||(26177151-26177228)
chr1 (439-517)||(41035826-41035904)
chr1 (550-642)||(369735-369828)
chr1 (572-739)||(9146773-9146940)
chr1 (612-739)||(26346919-26347044)
chr1 (538-624)||(34264597-34264683)
chr1 (438-516)||(40079160-40079238)
chr1 (661-739)||(40079160-40079237)
chr1 (439-516)||(4113005-4113082)
chr1 (439-516)||(39348352-39348428)
chr1 (654-739)||(51589234-51589318)
chr1 (453-516)||(12244975-12245038)
chr1 (663-737)||(17452680-17452753)
chr1 (439-505)||(33156752-33156818)
chr1 (441-514)||(17452680-17452753)
chr1 (624-737)||(17452790-17452902)
chr1 (659-724)||(25255333-25255398)
chr1 (658-735)||(31432226-31432303)
chr1 (661-722)||(42586438-42586499)
chr1 (615-695)||(51460003-51460083)
chr1 (441-516)||(3169774-3169849)
chr1 (660-739)||(35772272-35772350)
chr1 (586-700)||(5109296-5109410)
chr1 (550-632)||(12325420-12325501)
chr1 (672-722)||(38080628-38080678)
chr1 (439-516)||(15986332-15986409)
chr1 (606-738)||(50695777-50695909)
chr1 (562-701)||(52676409-52676547)
chr1 (562-626)||(11524882-11524946)
chr1 (562-626)||(11525097-11525161)
chr1 (586-736)||(5953660-5953810)
chr1 (439-514)||(17452827-17452902)
chr1 (660-739)||(25713401-25713479)
chr1 (654-701)||(29265998-29266045)
chr1 (661-720)||(32223789-32223848)
chr1 (661-740)||(38733389-38733467)
chr1 (461-516)||(51589000-51589055)
chr1 (461-516)||(51589234-51589289)
chr1 (441-516)||(51589814-51589889)
chr1 (461-516)||(52650792-52650847)
chr1 (661-739)||(29898920-29898997)
chr1 (661-739)||(31181512-31181589)
chr1 (551-621)||(33132366-33132436)
chr1 (663-739)||(51590048-51590121)
chr1 (673-739)||(52650782-52650847)
chr1 (465-514)||(26865383-26865432)
chr1 (439-516)||(31181512-31181589)
chr1 (670-739)||(39808474-39808541)
chr1 (550-643)||(40189108-40189200)
chr1 (463-516)||(52907392-52907445)
chr1 (675-739)||(12244975-12245038)
chr1 (663-739)||(25137304-25137379)
chr1 (637-737)||(35892301-35892400)
chr1 (436-516)||(49142961-49143041)
chr1 (683-739)||(49316166-49316221)
chr1 (433-516)||(4098156-4098239)
chr1 (660-739)||(4098161-4098239)
chr1 (622-693)||(17402635-17402706)
chr1 (660-739)||(25145483-25145561)
chr1 (439-514)||(25145719-25145794)
chr1 (439-510)||(35772043-35772114)
chr1 (461-516)||(38668133-38668188)
chr1 (441-516)||(40316051-40316126)
chr1 (661-720)||(42351859-42351918)
chr1 (439-514)||(43409817-43409891)
chr1 (429-516)||(51459694-51459781)
chr1 (441-516)||(52127729-52127803)
chr1 (664-739)||(52961590-52961664)
chr1 (434-516)||(855989-856071)
chr1 (654-700)||(2120123-2120169)
chr1 (661-739)||(2859391-2859468)
chr1 (596-721)||(12325494-12325619)
chr1 (661-739)||(15986332-15986409)
chr1 (661-699)||(20208527-20208565)
chr1 (439-517)||(30369842-30369920)
chr1 (439-505)||(31432229-31432295)
chr1 (660-738)||(33157230-33157307)
chr1 (439-516)||(2859391-2859468)
chr1 (676-737)||(3170011-3170071)
chr1 (461-514)||(3170011-3170064)
chr1 (439-516)||(8870909-8870986)
chr1 (467-516)||(16163175-16163224)
chr1 (439-516)||(25145484-25145561)
chr1 (576-657)||(40524789-40524870)
chr1 (673-722)||(46176750-46176799)
chr1 (663-739)||(52127729-52127803)
chr1 (670-739)||(52907392-52907460)
chr1 (659-739)||(11234224-11234303)
chr1 (559-687)||(12489097-12489220)
chr1 (696-740)||(17208797-17208840)
chr1 (572-652)||(26229660-26229740)
chr1 (661-737)||(26865357-26865432)
chr1 (461-517)||(27413589-27413645)
chr1 (440-516)||(34264710-34264786)
chr1 (663-739)||(40316051-40316126)
chr1 (460-516)||(49316165-49316221)
chr1 (461-516)||(2859648-2859703)
chr1 (638-697)||(3477152-3477211)
chr1 (441-480)||(5572669-5572708)
chr1 (461-512)||(9146575-9146626)
chr1 (462-517)||(9499253-9499307)
chr1 (670-709)||(11924958-11924997)
chr1 (474-517)||(17208797-17208840)
chr1 (461-516)||(25137324-25137379)
chr1 (439-490)||(25255345-25255396)
chr1 (461-516)||(25713401-25713456)
chr1 (453-516)||(26173469-26173532)
chr1 (461-516)||(26346989-26347044)
chr1 (661-740)||(27413589-27413667)
chr1 (465-516)||(28408067-28408118)
chr1 (461-516)||(31004458-31004513)
chr1 (661-740)||(40188984-40189062)
chr1 (661-739)||(855989-856066)
chr1 (661-739)||(4112539-4112616)
chr1 (683-721)||(5034336-5034374)
chr1 (661-695)||(20208228-20208262)
chr1 (470-516)||(26173254-26173300)
chr1 (670-739)||(28408047-28408118)
chr1 (439-509)||(29265968-29266038)
chr1 (661-739)||(39348118-39348195)
chr1 (660-722)||(43409830-43409892)
chr1 (564-701)||(49142761-49142898)
chr1 (461-515)||(50695855-50695909)
chr1 (659-737)||(50882674-50882751)
chr1 (661-739)||(51459704-51459781)
chr1 (550-599)||(768971-769020)
chr1 (654-727)||(11525016-11525089)
chr1 (448-517)||(11924928-11924997)
chr1 (439-516)||(20208527-20208602)
chr1 (439-516)||(29898920-29898997)
chr1 (463-516)||(32223771-32223824)
chr1 (439-504)||(42586438-42586503)
[»] chr2 (127 HSPs)
chr2 (439-739)||(40379208-40379520)
chr2 (439-719)||(16419294-16419587)
chr2 (439-739)||(2029777-2030089)
chr2 (461-739)||(15124569-15124859)
chr2 (526-739)||(14466274-14466486)
chr2 (526-739)||(33606153-33606365)
chr2 (439-739)||(5711438-5711751)
chr2 (533-701)||(16533357-16533525)
chr2 (453-690)||(40149016-40149264)
chr2 (548-701)||(93240-93393)
chr2 (526-739)||(17525198-17525414)
chr2 (572-739)||(17719408-17719574)
chr2 (515-722)||(24395887-24396096)
chr2 (538-739)||(36352037-36352235)
chr2 (526-739)||(32356394-32356601)
chr2 (526-657)||(37812367-37812498)
chr2 (586-739)||(2324248-2324400)
chr2 (587-740)||(13210533-13210686)
chr2 (586-739)||(5509087-5509239)
chr2 (586-739)||(17854853-17855005)
chr2 (593-701)||(93558-93666)
chr2 (44-327)||(30562426-30562694)
chr2 (522-652)||(44404021-44404152)
chr2 (560-657)||(18607142-18607239)
chr2 (572-712)||(21383579-21383720)
chr2 (572-665)||(34893506-34893599)
chr2 (550-702)||(33381076-33381231)
chr2 (586-739)||(28407716-28407869)
chr2 (630-739)||(29718336-29718444)
chr2 (663-739)||(19191611-19191686)
chr2 (617-739)||(27897561-27897681)
chr2 (661-739)||(16419510-16419587)
chr2 (570-652)||(30701166-30701248)
chr2 (579-724)||(10523041-10523185)
chr2 (661-738)||(17719575-17719651)
chr2 (26-194)||(30553965-30554134)
chr2 (439-515)||(17719575-17719651)
chr2 (448-516)||(32884115-32884183)
chr2 (550-701)||(13250145-13250296)
chr2 (661-739)||(25082536-25082613)
chr2 (658-739)||(2030012-2030092)
chr2 (611-739)||(14927110-14927238)
chr2 (439-516)||(28407792-28407869)
chr2 (562-627)||(31001883-31001948)
chr2 (448-516)||(2324248-2324316)
chr2 (539-627)||(21383402-21383490)
chr2 (461-516)||(2324482-2324537)
chr2 (586-689)||(2375087-2375190)
chr2 (631-722)||(15464793-15464884)
chr2 (441-516)||(19191611-19191686)
chr2 (663-737)||(8424898-8424971)
chr2 (663-737)||(13486343-13486417)
chr2 (673-739)||(40718218-40718283)
chr2 (670-739)||(2324482-2324550)
chr2 (441-514)||(8424898-8424971)
chr2 (642-739)||(21591789-21591886)
chr2 (439-516)||(25082536-25082613)
chr2 (670-739)||(32884115-32884183)
chr2 (551-727)||(42895266-42895443)
chr2 (448-516)||(5509321-5509389)
chr2 (661-736)||(15988423-15988498)
chr2 (663-739)||(17854693-17854768)
chr2 (440-516)||(29718336-29718412)
chr2 (586-666)||(36316209-36316289)
chr2 (663-739)||(40149004-40149079)
chr2 (441-516)||(17854693-17854768)
chr2 (580-726)||(38629861-38630008)
chr2 (462-516)||(17719408-17719462)
chr2 (439-516)||(9927919-9927996)
chr2 (649-722)||(10570994-10571067)
chr2 (439-516)||(14466409-14466486)
chr2 (461-510)||(15464783-15464832)
chr2 (463-516)||(17525361-17525414)
chr2 (439-515)||(9952083-9952158)
chr2 (464-516)||(17854953-17855005)
chr2 (662-735)||(21383284-21383359)
chr2 (440-516)||(32356394-32356469)
chr2 (663-739)||(36316052-36316127)
chr2 (461-516)||(5509087-5509142)
chr2 (461-516)||(16533555-16533610)
chr2 (661-712)||(31700744-31700795)
chr2 (441-516)||(36316052-36316127)
chr2 (661-739)||(36351924-36352002)
chr2 (461-516)||(36352180-36352235)
chr2 (461-516)||(37769964-37770019)
chr2 (461-516)||(40718228-40718283)
chr2 (453-514)||(5851694-5851756)
chr2 (661-738)||(9952083-9952158)
chr2 (462-516)||(37840345-37840399)
chr2 (670-739)||(5509321-5509389)
chr2 (673-737)||(5851692-5851756)
chr2 (439-516)||(19544370-19544446)
chr2 (471-516)||(33606085-33606130)
chr2 (670-739)||(37769951-37770019)
chr2 (608-701)||(5594072-5594166)
chr2 (559-643)||(19110346-19110430)
chr2 (629-685)||(31700939-31700995)
chr2 (663-739)||(33606056-33606130)
chr2 (458-514)||(35418432-35418488)
chr2 (659-739)||(37840345-37840424)
chr2 (586-625)||(11099526-11099565)
chr2 (661-740)||(15124547-15124625)
chr2 (439-513)||(15988423-15988498)
chr2 (597-668)||(33455881-33455951)
chr2 (672-739)||(42639624-42639690)
chr2 (579-630)||(42895593-42895644)
chr2 (454-516)||(11020566-11020628)
chr2 (461-514)||(13486343-13486397)
chr2 (572-722)||(15460998-15461148)
chr2 (661-739)||(19570973-19571050)
chr2 (661-739)||(30006578-30006655)
chr2 (661-739)||(30063266-30063343)
chr2 (654-736)||(31008563-31008644)
chr2 (686-724)||(43319710-43319748)
chr2 (472-513)||(93479-93520)
chr2 (472-513)||(93752-93793)
chr2 (461-514)||(1926462-1926515)
chr2 (475-516)||(3738941-3738982)
chr2 (671-736)||(12343759-12343823)
chr2 (453-522)||(13296367-13296436)
chr2 (439-516)||(15124782-15124859)
chr2 (439-516)||(19570973-19571050)
chr2 (439-504)||(24395883-24395948)
chr2 (439-516)||(27897605-27897681)
chr2 (441-514)||(31222531-31222604)
chr2 (439-516)||(31700744-31700824)
chr2 (439-516)||(33606288-33606365)
[»] chr5 (131 HSPs)
chr5 (439-739)||(41666756-41667069)
chr5 (439-739)||(18333464-18333776)
chr5 (439-739)||(15480330-15480644)
chr5 (439-687)||(95265-95526)
chr5 (526-739)||(9368603-9368815)
chr5 (526-717)||(24346600-24346792)
chr5 (461-737)||(26137130-26137419)
chr5 (526-717)||(24269969-24270160)
chr5 (439-740)||(25258093-25258378)
chr5 (439-740)||(25321883-25322168)
chr5 (537-739)||(24531607-24531808)
chr5 (522-739)||(6919289-6919504)
chr5 (437-701)||(32908715-32908991)
chr5 (538-695)||(17150344-17150501)
chr5 (527-739)||(24528548-24528759)
chr5 (572-739)||(6413567-6413733)
chr5 (525-739)||(17352532-17352744)
chr5 (550-699)||(43117694-43117843)
chr5 (439-643)||(8081112-8081330)
chr5 (526-739)||(38731702-38731914)
chr5 (439-722)||(33337237-33337515)
chr5 (435-665)||(20510637-20510879)
chr5 (586-739)||(8098326-8098477)
chr5 (515-645)||(15590039-15590169)
chr5 (461-621)||(17015900-17016069)
chr5 (586-739)||(21209845-21209997)
chr5 (550-696)||(11896572-11896716)
chr5 (611-739)||(2063683-2063809)
chr5 (526-648)||(11896254-11896377)
chr5 (526-609)||(30770148-30770231)
chr5 (530-648)||(13700693-13700811)
chr5 (562-680)||(16704618-16704736)
chr5 (525-639)||(18885334-18885448)
chr5 (654-739)||(8081105-8081190)
chr5 (550-739)||(20225049-20225237)
chr5 (586-722)||(29909645-29909781)
chr5 (618-737)||(13296683-13296800)
chr5 (661-739)||(95265-95342)
chr5 (655-739)||(15480565-15480650)
chr5 (663-739)||(27132994-27133069)
chr5 (661-739)||(28510099-28510176)
chr5 (576-699)||(2985925-2986049)
chr5 (587-701)||(17423794-17423909)
chr5 (661-740)||(20510641-20510719)
chr5 (654-736)||(1564559-1564640)
chr5 (660-722)||(25258092-25258154)
chr5 (660-722)||(25321882-25321944)
chr5 (539-636)||(6415782-6415879)
chr5 (439-516)||(24528548-24528625)
chr5 (439-516)||(24531607-24531684)
chr5 (439-504)||(33337454-33337519)
chr5 (439-516)||(35167394-35167471)
chr5 (563-643)||(17143231-17143311)
chr5 (441-517)||(24487646-24487722)
chr5 (550-722)||(31974240-31974401)
chr5 (441-516)||(8098326-8098400)
chr5 (660-739)||(13296900-13296978)
chr5 (441-516)||(21209922-21209997)
chr5 (629-740)||(24487612-24487722)
chr5 (441-516)||(27132994-27133069)
chr5 (660-739)||(38976941-38977019)
chr5 (661-739)||(12034698-12034775)
chr5 (661-739)||(35167394-35167471)
chr5 (439-516)||(2063733-2063809)
chr5 (527-620)||(11896135-11896228)
chr5 (439-516)||(13296900-13296977)
chr5 (663-740)||(26137110-26137186)
chr5 (439-516)||(28510099-28510176)
chr5 (674-722)||(7092173-7092221)
chr5 (659-739)||(43117890-43117969)
chr5 (461-516)||(60095-60150)
chr5 (672-739)||(7369732-7369798)
chr5 (461-516)||(7369732-7369787)
chr5 (461-516)||(9368603-9368658)
chr5 (673-740)||(17015890-17015956)
chr5 (538-620)||(11896026-11896108)
chr5 (661-739)||(19705911-19705988)
chr5 (442-516)||(24647704-24647778)
chr5 (562-615)||(2062049-2062102)
chr5 (663-739)||(8287810-8287884)
chr5 (586-739)||(19522095-19522247)
chr5 (439-516)||(19705911-19705988)
chr5 (660-737)||(21306897-21306973)
chr5 (660-737)||(21314735-21314811)
chr5 (663-739)||(7607602-7607677)
chr5 (649-701)||(13701055-13701107)
chr5 (461-516)||(170572-170627)
chr5 (461-516)||(6413447-6413502)
chr5 (461-516)||(8287810-8287864)
chr5 (439-514)||(13296683-13296757)
chr5 (437-516)||(16571457-16571536)
chr5 (465-516)||(19522095-19522146)
chr5 (439-514)||(21306897-21306972)
chr5 (439-514)||(21314735-21314810)
chr5 (660-739)||(24346499-24346577)
chr5 (461-516)||(24346522-24346577)
chr5 (659-722)||(24647720-24647783)
chr5 (461-516)||(42295587-42295642)
chr5 (661-739)||(60095-60172)
chr5 (657-735)||(15438999-15439076)
chr5 (661-739)||(32908717-32908794)
chr5 (611-739)||(42295587-42295711)
chr5 (674-739)||(170563-170627)
chr5 (663-724)||(21209709-21209770)
chr5 (660-721)||(24269869-24269930)
chr5 (461-514)||(24270126-24270179)
chr5 (461-514)||(24346758-24346811)
chr5 (586-675)||(27133151-27133240)
chr5 (461-514)||(29909508-29909561)
chr5 (461-514)||(29909742-29909795)
chr5 (439-516)||(38976941-38977018)
chr5 (439-516)||(43117890-43117967)
chr5 (441-516)||(6413658-6413733)
chr5 (461-508)||(7092165-7092212)
chr5 (461-516)||(15438885-15438940)
chr5 (461-516)||(17352456-17352511)
chr5 (597-719)||(29434102-29434223)
chr5 (465-516)||(37405097-37405148)
chr5 (439-513)||(1564566-1564640)
chr5 (661-739)||(9368838-9368915)
chr5 (589-722)||(35167556-35167690)
chr5 (654-699)||(1028390-1028435)
chr5 (654-695)||(1564501-1564542)
chr5 (463-516)||(2061961-2062014)
chr5 (439-516)||(9368838-9368915)
chr5 (670-739)||(16707033-16707101)
chr5 (661-710)||(18885499-18885548)
chr5 (441-490)||(21209709-21209758)
chr5 (663-708)||(24487510-24487555)
chr5 (573-618)||(34327517-34327562)
chr5 (663-716)||(34328941-34328994)
[»] chr6 (113 HSPs)
chr6 (439-739)||(4868576-4868889)
chr6 (526-739)||(13353209-13353421)
chr6 (526-739)||(33796334-33796546)
chr6 (526-740)||(33494546-33494759)
chr6 (526-739)||(12330043-12330255)
chr6 (439-739)||(9705028-9705339)
chr6 (439-739)||(6542708-6543019)
chr6 (439-657)||(17147659-17147890)
chr6 (441-739)||(30256586-30256895)
chr6 (521-739)||(3680020-3680236)
chr6 (439-739)||(6054177-6054488)
chr6 (550-739)||(33631693-33631880)
chr6 (521-739)||(13740689-13740906)
chr6 (521-739)||(13746189-13746406)
chr6 (573-737)||(6237618-6237776)
chr6 (553-737)||(24554127-24554309)
chr6 (527-661)||(31961028-31961162)
chr6 (526-740)||(6400719-6400923)
chr6 (602-739)||(8026397-8026533)
chr6 (551-700)||(32290774-32290923)
chr6 (586-739)||(19712722-19712876)
chr6 (597-739)||(21690730-21690871)
chr6 (572-740)||(7638758-7638925)
chr6 (575-722)||(30849315-30849462)
chr6 (515-701)||(34345443-34345628)
chr6 (586-739)||(5572540-5572691)
chr6 (663-739)||(8566960-8567034)
chr6 (603-740)||(11085588-11085724)
chr6 (609-700)||(8001496-8001588)
chr6 (586-739)||(15082066-15082219)
chr6 (439-517)||(25065093-25065171)
chr6 (515-657)||(30505591-30505733)
chr6 (659-739)||(11721913-11721992)
chr6 (615-739)||(27653225-27653348)
chr6 (440-516)||(30256586-30256662)
chr6 (441-516)||(8026397-8026472)
chr6 (660-739)||(19639111-19639189)
chr6 (661-740)||(25065093-25065171)
chr6 (441-516)||(27772722-27772797)
chr6 (654-740)||(30256820-30256904)
chr6 (439-517)||(33494546-33494624)
chr6 (439-516)||(11721913-11721990)
chr6 (663-739)||(12330292-12330366)
chr6 (439-516)||(19639112-19639189)
chr6 (437-509)||(6623407-6623479)
chr6 (580-727)||(10145667-10145815)
chr6 (663-739)||(27656466-27656541)
chr6 (663-722)||(8026628-8026687)
chr6 (551-642)||(20830617-20830708)
chr6 (550-701)||(3921603-3921755)
chr6 (661-710)||(4161845-4161894)
chr6 (661-710)||(4223465-4223514)
chr6 (439-516)||(13353209-13353286)
chr6 (463-516)||(19712722-19712775)
chr6 (649-722)||(20373595-20373667)
chr6 (435-516)||(27656466-27656547)
chr6 (586-739)||(27772722-27772872)
chr6 (539-739)||(27993518-27993719)
chr6 (461-514)||(28867978-28868031)
chr6 (439-516)||(33796334-33796411)
chr6 (441-516)||(8566960-8567034)
chr6 (441-516)||(12330180-12330255)
chr6 (441-516)||(12330292-12330366)
chr6 (461-516)||(21690730-21690785)
chr6 (453-516)||(27772954-27773017)
chr6 (439-517)||(11085588-11085666)
chr6 (661-739)||(19712960-19713037)
chr6 (682-739)||(4906814-4906870)
chr6 (661-722)||(6623409-6623470)
chr6 (441-506)||(8026622-8026687)
chr6 (439-516)||(19712960-19713037)
chr6 (572-701)||(26192558-26192687)
chr6 (664-720)||(5572386-5572442)
chr6 (660-739)||(7915858-7915935)
chr6 (661-737)||(17147659-17147734)
chr6 (677-737)||(28867972-28868031)
chr6 (461-516)||(2753266-2753321)
chr6 (441-516)||(27653225-27653300)
chr6 (661-739)||(2736166-2736243)
chr6 (673-739)||(2753266-2753331)
chr6 (442-516)||(5572386-5572460)
chr6 (660-722)||(6542707-6542769)
chr6 (673-719)||(7333093-7333139)
chr6 (661-739)||(13740924-13741001)
chr6 (661-739)||(13746424-13746501)
chr6 (561-638)||(1788841-1788918)
chr6 (439-516)||(3680020-3680097)
chr6 (468-517)||(6400874-6400923)
chr6 (670-739)||(12329952-12330020)
chr6 (439-516)||(13740924-13741001)
chr6 (439-516)||(13746424-13746501)
chr6 (663-740)||(15081909-15081985)
chr6 (461-514)||(24554127-24554180)
chr6 (586-627)||(28648872-28648913)
chr6 (604-692)||(3713396-3713484)
chr6 (448-516)||(12329952-12330020)
chr6 (461-517)||(15081929-15081985)
chr6 (661-701)||(16570204-16570244)
chr6 (609-740)||(20660878-20661010)
chr6 (572-740)||(30656542-30656709)
chr6 (461-516)||(4906814-4906869)
chr6 (577-624)||(5648816-5648863)
chr6 (461-516)||(6400641-6400696)
chr6 (672-739)||(16722817-16722883)
chr6 (461-516)||(16722828-16722883)
chr6 (661-711)||(10659505-10659555)
chr6 (659-740)||(12199801-12199882)
chr6 (544-642)||(12648504-12648602)
chr6 (660-725)||(5648670-5648735)
chr6 (672-701)||(6066020-6066049)
chr6 (463-516)||(15600944-15600997)
chr6 (461-514)||(20830760-20830813)
chr6 (467-516)||(33631638-33631687)
[»] chr8 (166 HSPs)
chr8 (521-739)||(20301269-20301486)
chr8 (521-739)||(21087901-21088118)
chr8 (526-739)||(11232293-11232505)
chr8 (531-739)||(41790667-41790873)
chr8 (526-739)||(39052793-39053005)
chr8 (528-737)||(3157425-3157634)
chr8 (515-740)||(20094648-20094871)
chr8 (439-737)||(8084137-8084447)
chr8 (439-739)||(12688080-12688392)
chr8 (527-701)||(31197660-31197831)
chr8 (527-739)||(5932049-5932260)
chr8 (593-739)||(24532352-24532497)
chr8 (527-665)||(18004196-18004332)
chr8 (470-739)||(7669427-7669695)
chr8 (572-739)||(15042794-15042962)
chr8 (579-739)||(37001234-37001396)
chr8 (550-722)||(37868471-37868643)
chr8 (544-686)||(5675938-5676080)
chr8 (550-700)||(10615440-10615590)
chr8 (598-739)||(4828076-4828216)
chr8 (439-643)||(35682780-35682997)
chr8 (527-648)||(39052637-39052758)
chr8 (595-739)||(19256753-19256896)
chr8 (526-636)||(3157108-3157218)
chr8 (562-739)||(8466623-8466800)
chr8 (439-627)||(39960076-39960277)
chr8 (586-739)||(16050037-16050189)
chr8 (586-739)||(12317054-12317206)
chr8 (539-739)||(42049563-42049763)
chr8 (565-700)||(422356-422491)
chr8 (629-739)||(11232161-11232270)
chr8 (526-627)||(5675833-5675934)
chr8 (565-721)||(10614842-10614998)
chr8 (661-739)||(39960199-39960277)
chr8 (576-739)||(8716122-8716285)
chr8 (586-704)||(26208172-26208291)
chr8 (578-721)||(36917355-36917498)
chr8 (660-739)||(37001472-37001550)
chr8 (589-739)||(34842686-34842835)
chr8 (661-739)||(42846604-42846682)
chr8 (654-739)||(10884072-10884156)
chr8 (439-516)||(39052928-39053005)
chr8 (663-739)||(19256587-19256662)
chr8 (663-739)||(24075307-24075382)
chr8 (644-739)||(17469826-17469920)
chr8 (441-516)||(19256587-19256662)
chr8 (441-516)||(24075307-24075382)
chr8 (661-739)||(35682780-35682857)
chr8 (439-516)||(22638178-22638255)
chr8 (612-739)||(28213053-28213179)
chr8 (440-516)||(8929025-8929101)
chr8 (663-739)||(17477073-17477148)
chr8 (565-689)||(31079478-31079602)
chr8 (526-740)||(31079661-31079876)
chr8 (550-614)||(37867956-37868020)
chr8 (659-739)||(38475755-38475834)
chr8 (566-710)||(38476074-38476223)
chr8 (672-739)||(4828301-4828367)
chr8 (461-516)||(4828301-4828356)
chr8 (461-516)||(17469826-17469881)
chr8 (461-516)||(17477073-17477128)
chr8 (441-516)||(19256821-19256896)
chr8 (661-736)||(27204975-27205049)
chr8 (661-736)||(27205073-27205147)
chr8 (661-736)||(27205171-27205245)
chr8 (461-516)||(38447448-38447503)
chr8 (438-516)||(42846603-42846682)
chr8 (661-739)||(3157326-3157403)
chr8 (557-639)||(15797138-15797220)
chr8 (661-739)||(22638178-22638255)
chr8 (439-513)||(27204975-27205049)
chr8 (439-513)||(27205073-27205147)
chr8 (439-513)||(27205171-27205245)
chr8 (662-739)||(8929025-8929101)
chr8 (439-516)||(11232193-11232270)
chr8 (439-516)||(11232428-11232505)
chr8 (439-516)||(24532420-24532497)
chr8 (439-516)||(37001472-37001549)
chr8 (439-516)||(38475755-38475832)
chr8 (459-516)||(39984822-39984879)
chr8 (448-516)||(4828076-4828144)
chr8 (663-739)||(39743537-39743612)
chr8 (663-722)||(422218-422277)
chr8 (672-739)||(5931959-5932025)
chr8 (461-516)||(5931970-5932025)
chr8 (439-514)||(12547109-12547183)
chr8 (660-739)||(12688315-12688393)
chr8 (461-516)||(34843125-34843180)
chr8 (661-740)||(35385810-35385889)
chr8 (441-516)||(39743537-39743612)
chr8 (597-688)||(42584728-42584819)
chr8 (661-739)||(10450008-10450085)
chr8 (661-739)||(15042669-15042746)
chr8 (661-739)||(25325654-25325731)
chr8 (677-739)||(38447442-38447503)
chr8 (526-619)||(5589839-5589932)
chr8 (661-722)||(12547122-12547183)
chr8 (439-516)||(15042669-15042746)
chr8 (439-516)||(15042885-15042962)
chr8 (439-516)||(20301269-20301346)
chr8 (439-516)||(21087901-21087978)
chr8 (441-514)||(28069358-28069431)
chr8 (663-739)||(34653159-34653233)
chr8 (439-516)||(37001234-37001311)
chr8 (550-642)||(7289323-7289415)
chr8 (453-517)||(16962259-16962323)
chr8 (459-522)||(35385830-35385894)
chr8 (683-739)||(39984822-39984877)
chr8 (661-709)||(44694708-44694756)
chr8 (461-516)||(5932205-5932260)
chr8 (661-736)||(6541925-6542000)
chr8 (461-516)||(7267486-7267541)
chr8 (461-516)||(7669427-7669482)
chr8 (672-735)||(26800522-26800584)
chr8 (461-512)||(26800533-26800584)
chr8 (562-609)||(38475871-38475918)
chr8 (461-516)||(38476285-38476340)
chr8 (629-739)||(5590335-5590444)
chr8 (661-723)||(10454449-10454511)
chr8 (439-516)||(10884072-10884149)
chr8 (661-739)||(18939296-18939373)
chr8 (550-608)||(29005994-29006052)
chr8 (661-739)||(38476285-38476362)
chr8 (663-712)||(4963388-4963437)
chr8 (439-516)||(10450008-10450085)
chr8 (439-516)||(12317054-12317131)
chr8 (439-516)||(18939296-18939373)
chr8 (682-739)||(20702804-20702861)
chr8 (581-634)||(29907865-29907918)
chr8 (439-516)||(41790667-41790743)
chr8 (439-516)||(42049686-42049763)
chr8 (663-739)||(7267466-7267541)
chr8 (539-700)||(8849226-8849389)
chr8 (633-677)||(8860814-8860858)
chr8 (572-739)||(10615638-10615805)
chr8 (660-740)||(18004094-18004173)
chr8 (586-634)||(19472408-19472456)
chr8 (586-634)||(19543333-19543381)
chr8 (586-634)||(19589315-19589363)
chr8 (465-517)||(20094819-20094871)
chr8 (461-516)||(20702804-20702860)
chr8 (661-701)||(24532285-24532325)
chr8 (632-692)||(29005918-29005978)
chr8 (550-614)||(37868196-37868260)
chr8 (461-516)||(5590389-5590444)
chr8 (462-517)||(6559471-6559526)
chr8 (473-516)||(7729949-7729992)
chr8 (659-722)||(10615153-10615216)
chr8 (461-516)||(34842686-34842741)
chr8 (562-609)||(38475974-38476021)
chr8 (673-724)||(45122367-45122418)
chr8 (661-739)||(3157008-3157085)
chr8 (461-514)||(3157580-3157634)
chr8 (588-686)||(9397800-9397898)
chr8 (586-668)||(17476909-17476991)
chr8 (439-517)||(18004095-18004173)
chr8 (532-609)||(28213208-28213283)
chr8 (450-516)||(29099750-29099816)
chr8 (586-648)||(34842948-34843010)
chr8 (586-668)||(39743373-39743455)
chr8 (463-516)||(8466747-8466800)
chr8 (526-582)||(10615038-10615095)
chr8 (467-516)||(20515152-20515201)
chr8 (439-516)||(25325654-25325731)
chr8 (682-739)||(34843125-34843181)
chr8 (672-709)||(36907438-36907475)
[»] chr3 (137 HSPs)
chr3 (526-739)||(4155332-4155544)
chr3 (439-739)||(35038193-35038504)
chr3 (448-739)||(20327622-20327925)
chr3 (526-739)||(13574783-13574997)
chr3 (538-739)||(16239599-16239800)
chr3 (526-722)||(34992636-34992826)
chr3 (557-713)||(20303280-20303436)
chr3 (606-739)||(54567900-54568032)
chr3 (526-739)||(31317237-31317451)
chr3 (580-740)||(45828026-45828185)
chr3 (461-639)||(20303085-20303276)
chr3 (586-739)||(1723000-1723152)
chr3 (586-739)||(11589793-11589945)
chr3 (614-739)||(16926901-16927025)
chr3 (565-700)||(26272227-26272362)
chr3 (527-657)||(19954318-19954447)
chr3 (552-739)||(49629613-49629800)
chr3 (629-739)||(54368524-54368633)
chr3 (572-701)||(8142557-8142686)
chr3 (538-701)||(26753397-26753560)
chr3 (526-620)||(39683367-39683461)
chr3 (562-648)||(46139360-46139446)
chr3 (544-668)||(22775516-22775641)
chr3 (545-661)||(39269159-39269275)
chr3 (596-726)||(12930061-12930192)
chr3 (516-658)||(52724075-52724217)
chr3 (439-516)||(1723075-1723152)
chr3 (439-516)||(16926948-16927025)
chr3 (596-721)||(28087149-28087274)
chr3 (572-720)||(37246763-37246911)
chr3 (663-739)||(50052540-50052616)
chr3 (441-516)||(11589793-11589868)
chr3 (660-722)||(24866221-24866283)
chr3 (439-516)||(4155332-4155409)
chr3 (586-739)||(27670317-27670468)
chr3 (439-516)||(54567900-54567977)
chr3 (657-737)||(20303059-20303138)
chr3 (657-737)||(20327609-20327688)
chr3 (581-712)||(33640079-33640211)
chr3 (463-514)||(1800225-1800276)
chr3 (660-739)||(8018976-8019054)
chr3 (453-516)||(9272969-9273032)
chr3 (664-739)||(33205473-33205547)
chr3 (661-740)||(34610567-34610646)
chr3 (461-516)||(49629613-49629668)
chr3 (661-739)||(4155567-4155644)
chr3 (638-739)||(45138946-45139047)
chr3 (439-516)||(8018976-8019053)
chr3 (439-516)||(16239599-16239676)
chr3 (659-739)||(17638243-17638321)
chr3 (572-657)||(24866132-24866216)
chr3 (672-737)||(38791460-38791524)
chr3 (463-516)||(50930710-50930763)
chr3 (439-516)||(54368524-54368601)
chr3 (581-645)||(21809059-21809123)
chr3 (566-690)||(50052677-50052800)
chr3 (515-603)||(54368630-54368718)
chr3 (461-516)||(472081-472136)
chr3 (465-516)||(45138827-45138878)
chr3 (663-722)||(47702410-47702469)
chr3 (661-739)||(50083079-50083157)
chr3 (661-739)||(472059-472136)
chr3 (601-739)||(9272969-9273106)
chr3 (581-643)||(11659600-11659662)
chr3 (664-738)||(13574686-13574759)
chr3 (459-513)||(21809166-21809220)
chr3 (580-626)||(21888525-21888571)
chr3 (629-739)||(22729108-22729217)
chr3 (454-516)||(23708238-23708300)
chr3 (454-516)||(23726694-23726756)
chr3 (454-516)||(23745150-23745212)
chr3 (454-516)||(24063675-24063737)
chr3 (661-739)||(31317474-31317551)
chr3 (661-739)||(41915179-41915255)
chr3 (672-737)||(1800225-1800289)
chr3 (526-619)||(22729620-22729713)
chr3 (605-686)||(35018535-35018616)
chr3 (439-516)||(39269339-39269416)
chr3 (439-516)||(39620334-39620411)
chr3 (463-516)||(45138994-45139047)
chr3 (464-516)||(23691216-23691268)
chr3 (464-516)||(23708016-23708068)
chr3 (464-516)||(23726472-23726524)
chr3 (464-516)||(23744928-23744980)
chr3 (464-516)||(24063453-24063505)
chr3 (647-739)||(39269339-39269430)
chr3 (660-704)||(39620368-39620412)
chr3 (461-517)||(45828026-45828082)
chr3 (440-516)||(45828254-45828330)
chr3 (441-516)||(50052540-50052616)
chr3 (437-516)||(50083077-50083157)
chr3 (670-709)||(1353485-1353524)
chr3 (461-516)||(9273203-9273258)
chr3 (461-516)||(13574942-13574997)
chr3 (454-517)||(16239834-16239897)
chr3 (461-516)||(23610392-23610447)
chr3 (439-502)||(24866219-24866282)
chr3 (461-516)||(27670413-27670468)
chr3 (661-739)||(18757850-18757927)
chr3 (454-516)||(23691438-23691500)
chr3 (581-687)||(34659156-34659261)
chr3 (665-739)||(45138805-45138878)
chr3 (633-701)||(1800070-1800139)
chr3 (439-516)||(4155567-4155644)
chr3 (442-515)||(13574686-13574759)
chr3 (562-718)||(15019415-15019572)
chr3 (439-516)||(17638243-17638319)
chr3 (439-516)||(18757850-18757927)
chr3 (439-516)||(22729108-22729185)
chr3 (659-736)||(27086601-27086677)
chr3 (439-516)||(31317237-31317313)
chr3 (461-517)||(34610567-34610624)
chr3 (662-739)||(45828254-45828330)
chr3 (661-721)||(2806285-2806345)
chr3 (461-513)||(7697419-7697471)
chr3 (672-739)||(13741111-13741178)
chr3 (670-721)||(6487341-6487392)
chr3 (661-736)||(7697397-7697471)
chr3 (672-739)||(9273203-9273269)
chr3 (437-516)||(41915179-41915257)
chr3 (661-740)||(44576254-44576332)
chr3 (453-491)||(20303398-20303436)
chr3 (688-730)||(21808798-21808840)
chr3 (605-739)||(29215758-29215890)
chr3 (670-720)||(32215523-32215573)
chr3 (661-739)||(42420832-42420909)
chr3 (439-517)||(44576254-44576332)
chr3 (685-739)||(50930710-50930763)
chr3 (663-724)||(11590027-11590088)
chr3 (654-695)||(21833399-21833440)
chr3 (678-739)||(23610387-23610447)
chr3 (661-694)||(27086693-27086726)
chr3 (654-739)||(30179700-30179784)
chr3 (439-516)||(31317474-31317551)
chr3 (461-514)||(38791471-38791524)
chr3 (587-691)||(39620147-39620252)
chr3 (441-502)||(47702410-47702471)
[»] scaffold0692 (4 HSPs)
scaffold0692 (544-739)||(5636-5830)
scaffold0692 (439-516)||(5753-5830)
scaffold0692 (461-516)||(5565-5620)
scaffold0692 (673-739)||(5555-5620)
[»] scaffold0519 (1 HSPs)
scaffold0519 (439-739)||(1924-2236)
[»] chr7 (155 HSPs)
chr7 (526-739)||(21861302-21861514)
chr7 (526-739)||(29469613-29469825)
chr7 (527-739)||(25620144-25620355)
chr7 (527-739)||(36277091-36277302)
chr7 (526-700)||(33834237-33834411)
chr7 (526-699)||(1596640-1596813)
chr7 (537-722)||(48661429-48661615)
chr7 (526-737)||(33996178-33996385)
chr7 (550-722)||(4886353-4886525)
chr7 (521-739)||(22574613-22574826)
chr7 (439-737)||(31892161-31892472)
chr7 (528-737)||(31485525-31485733)
chr7 (550-739)||(3519927-3520116)
chr7 (515-740)||(21821813-21822035)
chr7 (526-739)||(2404273-2404484)
chr7 (522-700)||(18826348-18826526)
chr7 (548-700)||(36993194-36993346)
chr7 (526-625)||(3519824-3519923)
chr7 (522-643)||(2315121-2315242)
chr7 (586-739)||(34027401-34027553)
chr7 (550-701)||(28080709-28080863)
chr7 (573-739)||(44874489-44874655)
chr7 (515-679)||(6001523-6001687)
chr7 (597-740)||(10903092-10903234)
chr7 (559-739)||(48417411-48417591)
chr7 (586-739)||(26561997-26562149)
chr7 (526-634)||(40746132-40746239)
chr7 (586-737)||(31257191-31257341)
chr7 (586-739)||(2544373-2544523)
chr7 (633-739)||(3038055-3038160)
chr7 (573-722)||(4506956-4507105)
chr7 (572-678)||(20305358-20305468)
chr7 (602-698)||(10882179-10882275)
chr7 (604-739)||(26239857-26239992)
chr7 (539-722)||(30727231-30727415)
chr7 (526-692)||(9688969-9689130)
chr7 (586-739)||(40746273-40746425)
chr7 (544-702)||(5871693-5871852)
chr7 (660-739)||(47710451-47710529)
chr7 (660-739)||(47722107-47722185)
chr7 (629-739)||(17202187-17202296)
chr7 (562-719)||(32292546-32292703)
chr7 (439-516)||(25620144-25620221)
chr7 (660-740)||(21054951-21055030)
chr7 (659-739)||(32879611-32879691)
chr7 (441-516)||(34027401-34027476)
chr7 (439-517)||(21054952-21055030)
chr7 (439-584)||(48243060-48243216)
chr7 (661-739)||(48243060-48243137)
chr7 (586-739)||(32278995-32279142)
chr7 (448-516)||(17202187-17202255)
chr7 (663-739)||(31257032-31257107)
chr7 (647-739)||(48243422-48243513)
chr7 (441-516)||(29469613-29469688)
chr7 (461-516)||(48243458-48243513)
chr7 (661-739)||(6634863-6634940)
chr7 (673-739)||(15317560-15317625)
chr7 (439-517)||(21821813-21821891)
chr7 (661-739)||(34027635-34027712)
chr7 (439-516)||(3038083-3038160)
chr7 (560-680)||(5871853-5871974)
chr7 (439-516)||(34027635-34027712)
chr7 (439-516)||(43085536-43085613)
chr7 (439-516)||(47710451-47710528)
chr7 (439-516)||(47722107-47722184)
chr7 (448-516)||(2544455-2544523)
chr7 (663-739)||(29469848-29469923)
chr7 (663-739)||(40746506-40746581)
chr7 (441-516)||(29469848-29469923)
chr7 (461-516)||(31257052-31257107)
chr7 (654-701)||(40121916-40121963)
chr7 (664-739)||(44874348-44874422)
chr7 (633-711)||(11743063-11743141)
chr7 (661-739)||(21861537-21861614)
chr7 (439-516)||(32879613-32879691)
chr7 (670-739)||(2544223-2544291)
chr7 (467-516)||(10882032-10882081)
chr7 (654-739)||(20305655-20305739)
chr7 (439-516)||(21861537-21861614)
chr7 (562-726)||(22339503-22339667)
chr7 (441-514)||(31257268-31257341)
chr7 (439-516)||(36277225-36277302)
chr7 (439-516)||(43075309-43075386)
chr7 (654-722)||(6782885-6782953)
chr7 (663-739)||(10882007-10882081)
chr7 (670-722)||(11211687-11211739)
chr7 (461-513)||(14540973-14541025)
chr7 (537-621)||(17948360-17948444)
chr7 (661-737)||(22574845-22574920)
chr7 (436-516)||(44874342-44874422)
chr7 (586-740)||(1793753-1793908)
chr7 (663-718)||(1793948-1794003)
chr7 (672-739)||(3392990-3393056)
chr7 (595-690)||(4267912-4268007)
chr7 (473-516)||(4454784-4454827)
chr7 (461-516)||(15317560-15317615)
chr7 (461-516)||(20305684-20305739)
chr7 (461-516)||(23839098-23839153)
chr7 (461-516)||(26239937-26239992)
chr7 (461-516)||(26562094-26562149)
chr7 (461-516)||(31485445-31485500)
chr7 (439-514)||(33996310-33996385)
chr7 (660-739)||(36276989-36277067)
chr7 (660-739)||(36993072-36993150)
chr7 (461-516)||(40746506-40746561)
chr7 (453-516)||(40898728-40898791)
chr7 (461-516)||(47849579-47849634)
chr7 (672-739)||(47849798-47849864)
chr7 (659-737)||(1596838-1596915)
chr7 (661-739)||(6991763-6991840)
chr7 (677-739)||(23839092-23839153)
chr7 (661-739)||(43085536-43085613)
chr7 (462-516)||(43089230-43089284)
chr7 (661-699)||(43688159-43688197)
chr7 (461-514)||(1596838-1596891)
chr7 (464-517)||(1793753-1793806)
chr7 (460-517)||(6001455-6001512)
chr7 (439-516)||(6634863-6634940)
chr7 (439-516)||(21861302-21861379)
chr7 (661-722)||(32474524-32474585)
chr7 (631-739)||(40898890-40898998)
chr7 (461-514)||(40991765-40991818)
chr7 (439-516)||(43688159-43688235)
chr7 (437-513)||(1000560-1000636)
chr7 (661-701)||(7786253-7786293)
chr7 (461-517)||(10903092-10903148)
chr7 (462-514)||(11211701-11211752)
chr7 (552-616)||(35308271-35308335)
chr7 (661-701)||(48420741-48420781)
chr7 (661-736)||(1000560-1000634)
chr7 (461-516)||(2544236-2544291)
chr7 (461-516)||(23796205-23796260)
chr7 (672-739)||(32278895-32278961)
chr7 (461-516)||(40746273-40746328)
chr7 (672-739)||(47849579-47849645)
chr7 (557-627)||(1936243-1936312)
chr7 (439-517)||(4886336-4886414)
chr7 (439-509)||(32474515-32474585)
chr7 (661-739)||(43075309-43075386)
chr7 (654-712)||(47955339-47955397)
chr7 (654-712)||(47955420-47955478)
chr7 (654-712)||(47955501-47955559)
chr7 (654-712)||(47955582-47955640)
chr7 (654-712)||(47955663-47955721)
chr7 (654-712)||(47955744-47955802)
chr7 (581-614)||(1751734-1751767)
chr7 (557-622)||(14540871-14540936)
chr7 (661-722)||(21822067-21822128)
chr7 (670-739)||(31485433-31485500)
chr7 (461-514)||(31485680-31485733)
chr7 (463-516)||(32292527-32292580)
chr7 (552-625)||(35308366-35308439)
chr7 (460-516)||(46452640-46452697)
chr7 (579-616)||(47849686-47849723)
chr7 (461-514)||(48661576-48661629)
[»] scaffold0048 (4 HSPs)
scaffold0048 (527-740)||(81849-82060)
scaffold0048 (661-709)||(82113-82161)
scaffold0048 (433-512)||(82088-82167)
scaffold0048 (439-517)||(81849-81927)
[»] scaffold0129 (2 HSPs)
scaffold0129 (565-739)||(14311-14484)
scaffold0129 (439-516)||(14311-14388)
[»] scaffold0092 (3 HSPs)
scaffold0092 (515-739)||(5663-5886)
scaffold0092 (439-516)||(5663-5740)
scaffold0092 (439-517)||(5897-5975)
[»] scaffold0400 (1 HSPs)
scaffold0400 (588-739)||(3852-4003)
[»] scaffold0365 (1 HSPs)
scaffold0365 (588-739)||(4496-4647)
[»] scaffold0047 (1 HSPs)
scaffold0047 (458-722)||(12671-12947)
[»] scaffold0005 (3 HSPs)
scaffold0005 (586-739)||(56467-56619)
scaffold0005 (441-516)||(56467-56542)
scaffold0005 (661-722)||(288656-288717)
[»] scaffold0366 (2 HSPs)
scaffold0366 (522-652)||(14498-14629)
scaffold0366 (522-652)||(10832-10963)
[»] scaffold0045 (2 HSPs)
scaffold0045 (576-739)||(41120-41281)
scaffold0045 (670-738)||(40978-41045)
[»] scaffold0459 (1 HSPs)
scaffold0459 (522-652)||(13191-13322)
[»] scaffold0729 (1 HSPs)
scaffold0729 (526-624)||(2616-2714)
[»] scaffold0083 (3 HSPs)
scaffold0083 (550-664)||(51355-51469)
scaffold0083 (629-739)||(51244-51353)
scaffold0083 (461-516)||(51244-51299)
[»] scaffold0481 (2 HSPs)
scaffold0481 (594-739)||(3403-3547)
scaffold0481 (461-516)||(3492-3547)
[»] scaffold0003 (4 HSPs)
scaffold0003 (580-723)||(102295-102438)
scaffold0003 (580-636)||(87727-87783)
scaffold0003 (439-516)||(347570-347647)
scaffold0003 (661-712)||(347570-347621)
[»] scaffold0334 (2 HSPs)
scaffold0334 (461-516)||(4450-4505)
scaffold0334 (664-739)||(4431-4505)
[»] scaffold0766 (2 HSPs)
scaffold0766 (665-739)||(6282-6355)
scaffold0766 (443-516)||(6282-6355)
[»] scaffold0181 (2 HSPs)
scaffold0181 (661-721)||(20964-21024)
scaffold0181 (439-514)||(20949-21024)
[»] scaffold0050 (1 HSPs)
scaffold0050 (464-516)||(69557-69609)
[»] scaffold0542 (1 HSPs)
scaffold0542 (573-647)||(5728-5802)
[»] scaffold0041 (2 HSPs)
scaffold0041 (453-516)||(67493-67556)
scaffold0041 (631-739)||(67286-67394)


Alignment Details
Target: chr4 (Bit Score: 143; Significance: 1e-74; HSPs: 173)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 143; E-Value: 1e-74
Query Start/End: Original strand, 439 - 740
Target Start/End: Original strand, 35796741 - 35797054
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaacatcttatatt------------- 525  Q
    |||||||| | || |||||||||||||||||| ||||||||||| ||||||| || ||||||||||||||||||||||  || |  |                 
35796741 tcttagaaatggtggttggacttaacacaacctcacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcatgccatgtcctgtc 35796840  T
526 cgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcag 625  Q
    |||||||| || ||||| ||||| |||||| |||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
35796841 cgatgtggaactcttaacacaccccctcacgaccagcactattgggcttggttcgtggagataaatggtgggtggcccgatagcggaaacctgatagcag 35796940  T
626 gtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtcc 725  Q
    |||| ||||||||||| |||||| ||| |||| |||||||||| | || ||||||| |||||||||||||||||||||||||||||| ||||||||| ||    
35796941 gtagtccaatggatctcgaagaggctctgataccatcttagaaatggtagttgggcttaacacaaccccacaaaactggtttgtgaggtgaggattg-cc 35797039  T
726 ctcacttataaacat 740  Q
    | |||||||||||||    
35797040 cccacttataaacat 35797054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 131; E-Value: 2e-67
Query Start/End: Original strand, 439 - 739
Target Start/End: Complemental strand, 35788979 - 35788667
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca-------------tcttatatt 525  Q
    |||||||| |||| ||||| | |||||||||||||||||||||| |||||||||| ||||||||||||||||||||||             | || |||     
35788979 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgagatgaggattgcccccacttataaacacattgtcaggccatgttctatc 35788880  T
526 cgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcag 625  Q
    ||||||||||| ||||| || || |||||| |||||||||||||| ||||||||||||| ||||||||||||||||| |||| |||||||||||||||||    
35788879 cgatgtgggactcttaacacccc-cctcacgaccagcactattgggcttggttcgtggacataaatggtgggtggcctgataacggaaacctgatagcag 35788781  T
626 gtagcccaatggatctt-gaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtc 724  Q
    || |||||| ||||||| || ||| ||| |||| |||||||||| |||||||||||||||||||||||||| ||||| || ||||||| ||||||||| |    
35788780 gtggcccaacggatcttggaggaggctctgataccatcttagaaatcgtggttgggcctaacacaaccccataaaaccggcttgtgaggtgaggattg-c 35788682  T
725 cctcacttataaaca 739  Q
    || ||||||||||||    
35788681 ccccacttataaaca 35788667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 122; E-Value: 4e-62
Query Start/End: Original strand, 437 - 737
Target Start/End: Original strand, 22231070 - 22231382
Alignment:
437 agtcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaacatcttat-------------a 523  Q
    |||||||||| |||| ||||||| ||| |||||||||||||||||| ||||||| || |||||| |||||||||||||||  || |             |    
22231070 agtcttagaaatcgtggttggacctaatacaaccccacaaaaccggcttgtgaggtgaggattgtccccacttataaacacattgtcaggccatatccta 22231169  T
524 ttcgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagc 623  Q
    | |||||| |||| ||||| ||| | |||||  |  ||||||||||| ||||||||||||| ||||||||| ||||||||||||||||||||||||||||    
22231170 tccgatgtaggactcttaacacatcccctcatgatgagcactattgggcttggttcgtggacataaatggtaggtggcccgatagcggaaacctgatagc 22231269  T
624 aggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgt 723  Q
    |||| ||||||||||| ||| |||| ||| |||| |||||||||| |||||||||||||||||||||||||||||||| || ||||||| |||||||||     
22231270 aggtggcccaatggattttggagaggctctgataccatcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattg- 22231368  T
724 ccctcacttataaa 737  Q
    ||| ||||||||||    
22231369 cccccacttataaa 22231382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 114; E-Value: 2e-57
Query Start/End: Original strand, 550 - 739
Target Start/End: Original strand, 35819016 - 35819204
Alignment:
550 cctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagaga 649  Q
    ||||||||||||||||||||| ||||||||||||| |||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||  |||||    
35819016 cctcacaaccagcactattgggcttggttcgtggacataaatggtgggtgacccgatagcggaaacctgatagcaggtggcccaatggatcttagagaga 35819115  T
650 ctcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    ||| |||  ||||||| || ||||||||||||||||||||||| ||||||||||| |||||||  |||||||| ||| ||| ||||||||    
35819116 ctctgatgccatcttaaaaatcgtggttgggcctaacacaacctcacaaaactggcttgtgaggcgaggattg-cccccacatataaaca 35819204  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 113; E-Value: 9e-57
Query Start/End: Original strand, 527 - 739
Target Start/End: Original strand, 40717306 - 40717517
Alignment:
527 gatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcagg 626  Q
    |||||||||| ||||| ||||| |||||| |||||||||||| | ||||||| ||||| ||||||||||||||| ||||||||||||||||||| |||||    
40717306 gatgtgggactcttaacacaccccctcacgaccagcactattaggcttggtttgtggacataaatggtgggtggtccgatagcggaaacctgatggcagg 40717405  T
627 tagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccc 726  Q
    | ||||||||||| ||| |||| ||| |||| |||||||||| |||||||||||||||||||||||||||||||| |  || |||| ||||||||| |||    
40717406 tggcccaatggatattggagaggctctgataccatcttagaaatcgtggttgggcctaacacaaccccacaaaaccgacttttgaggtgaggattg-ccc 40717504  T
727 tcacttataaaca 739  Q
     ||||||||||||    
40717505 ccacttataaaca 40717517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 113; E-Value: 9e-57
Query Start/End: Original strand, 439 - 735
Target Start/End: Original strand, 50543329 - 50543639
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaacatcttat-------------att 525  Q
    |||||||| |||| ||||| | |||||||||||||||||||||| ||||| | || |||||||||||||||||| |||  || |             ||     
50543329 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtggggtgaggattgcccccacttatacacacattgtcagaccatcacctatc 50543428  T
526 cgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcag 625  Q
    ||||||||| | ||||| ||||| |||||| |||| ||||||||| ||||||||||||| |||||||||||||||||||||| |||||||||||||||||    
50543429 cgatgtggggctcttaacacaccccctcacgaccaacactattgggcttggttcgtggacataaatggtgggtggcccgataacggaaacctgatagcag 50543528  T
626 gtagccca--atggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgt 723  Q
    || | | |  |||||||||| |||| ||| ||||||||||||||| |||||||||||||||||||||| ||||||||| || ||||||| |||||||||     
50543529 gtggtcaaatatggatcttggagaggctctgatatcatcttagaaatcgtggttgggcctaacacaactccacaaaaccggcttgtgaggtgaggattg- 50543627  T
724 ccctcacttata 735  Q
    ||| ||||||||    
50543628 cccccacttata 50543639  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 112; E-Value: 3e-56
Query Start/End: Original strand, 441 - 683
Target Start/End: Original strand, 28245527 - 28245782
Alignment:
441 ttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaacatcttat-------------attcg 527  Q
    |||||| |||||||||| | |||||||||||||||||||||| ||||||| || ||||||||||||||||||||||  || |             || ||    
28245527 ttagaaatcgtagttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcaggccatcacctatccg 28245626  T
528 atgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggt 627  Q
    ||||| ||| ||||| ||||| | |||| |||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
28245627 atgtgagactcttaacacaccccatcacgaccagcactattgggcttggttcgtggacataaatggtgggtggcccgatagcggaaacctgatagcaggt 28245726  T
628 agcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcct 683  Q
     ||||||||||||||| |||| ||| |||| ||| |||||| ||||||||||||||    
28245727 ggcccaatggatcttggagaggctctgataccatattagaaatcgtggttgggcct 28245782  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 92; E-Value: 3e-44
Query Start/End: Original strand, 526 - 739
Target Start/End: Complemental strand, 52559789 - 52559575
Alignment:
526 cgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcag 625  Q
    ||||||||||   |||| ||||| ||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||| |  |||| |||||||||    
52559789 cgatgtgggatttttaacacaccccctcacaaccagcactattgggcttggttcgtggacataaatggtgggtggcccgataacataaacttgatagcag 52559690  T
626 gtagccc-aatggatc-ttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgt 723  Q
    || |||| || ||||| |||| ||| ||| ||||  ||||||||| || ||||||||||||||||||||||||||||| || ||||||| ||| |||||     
52559689 gtggcccaaacggatctttgaggaggctctgatactatcttagaaatcatggttgggcctaacacaaccccacaaaaccggcttgtgaggtgatgattg- 52559591  T
724 ccctcacttataaaca 739  Q
    ||| ||||||||||||    
52559590 cccccacttataaaca 52559575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 86; E-Value: 1e-40
Query Start/End: Original strand, 527 - 740
Target Start/End: Complemental strand, 6218423 - 6218211
Alignment:
527 gatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcagg 626  Q
    |||||| ||| ||||| ||||| |||||| |||||||||||||| |||||||| || | ||||||| |||||| || ||||||||||||||||||| |||    
6218423 gatgtgagactcttaacacaccccctcacgaccagcactattgggcttggttcttgtacataaatgatgggtgacctgatagcggaaacctgatagtagg 6218324  T
627 tagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccc 726  Q
    |   ||||||||||||| |||| ||| |||| |||||||||| ||||||||| | |||||||||| ||||||||| |  ||||||| ||| ||||| |||    
6218323 tgatccaatggatcttggagaggctctgataccatcttagaaatcgtggttgtgtctaacacaactccacaaaaccgtcttgtgaggtgaagattg-ccc 6218225  T
727 tcacttataaacat 740  Q
     |||||||||||||    
6218224 ccacttataaacat 6218211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 76; E-Value: 1e-34
Query Start/End: Original strand, 541 - 724
Target Start/End: Complemental strand, 4645847 - 4645664
Alignment:
541 aatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatc 640  Q
    |||||||| |||||| |||| |||| |||| |||| |||||||| |||| |||||||||||||||||||||||||||||||||||||  |||||||||||    
4645847 aatacaccccctcacgaccaacacttttgggcttgattcgtggacataattggtgggtggcccgatagcggaaacctgatagcaggtgacccaatggatc 4645748  T
641 ttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtc 724  Q
    ||  |||| ||| ||||  |||||| || || |||||| | ||||||||| |||||||||| || |||| || ||| |||||||    
4645747 tttgagaggctctgatactatcttataaatcatggttgagtctaacacaatcccacaaaaccggcttgtaaggtgatgattgtc 4645664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 75; E-Value: 4e-34
Query Start/End: Original strand, 526 - 636
Target Start/End: Original strand, 5398574 - 5398684
Alignment:
526 cgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcag 625  Q
    ||||||||||| ||||| ||||| |||||| |||||||||||| | ||||||||||||| ||||||||||||||| ||||||||||||||||||||||||    
5398574 cgatgtgggactcttaacacaccccctcacgaccagcactatttggcttggttcgtggacataaatggtgggtggtccgatagcggaaacctgatagcag 5398673  T
626 gtagcccaatg 636  Q
    || ||||||||    
5398674 gtggcccaatg 5398684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 73; E-Value: 6e-33
Query Start/End: Original strand, 531 - 739
Target Start/End: Original strand, 11036615 - 11036822
Alignment:
531 tgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagc 630  Q
    |||||| ||||| ||| | |||||| ||| ||| |||||  |||||||| |||| || |||||||||||||| |||||||||||||| |||| |||| ||    
11036615 tgggactcttaacacaacccctcacgacctgcaatattgagcttggttcatggacattaatggtgggtggcctgatagcggaaacctaatagtaggtggc 11036714  T
631 ccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcac 730  Q
    ||||||||||||  || | ||| |||| ||||||| || | |||||| ||||||||||||||||||| ||  || ||||||| ||||||||| ||| |||    
11036715 ccaatggatcttagagtggctctgataccatcttaaaaattgtggttaggcctaacacaaccccacacaatcggcttgtgaggtgaggattg-cccccac 11036813  T
731 ttataaaca 739  Q
    |||||||||    
11036814 ttataaaca 11036822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 71; E-Value: 1e-31
Query Start/End: Original strand, 572 - 722
Target Start/End: Original strand, 4905646 - 4905796
Alignment:
572 cttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactc 671  Q
    |||| |||||| | |||||||||||||||||||||||| ||||||| ||||||||| |||||||||| |||| |||| ||| ||||||||||||||| ||    
4905646 cttgattcgtgaacataaatggtgggtggcccgatagcagaaacctaatagcaggtggcccaatggagcttggagaggctctgatatcatcttagaaatc 4905745  T
672 gtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattg 722  Q
     |||||| |||||||| ||| ||| ||||| || |||| || |||||||||    
4905746 atggttgagcctaacaaaactccaaaaaacgggcttgttaggtgaggattg 4905796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 71; E-Value: 1e-31
Query Start/End: Original strand, 562 - 739
Target Start/End: Complemental strand, 22822535 - 22822358
Alignment:
562 cactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttg-aagagactcagatatca 660  Q
    |||||||||||||||| ||||||  || |||||| |||||||||||||||||||||||||||||||||||||| |  ||||| | ||| ||| ||||  |    
22822535 cactattggacttggtgcgtggatgtatatggtgagtggcccgatagcggaaacctgatagcaggtagcccaacgagtcttgtaggaggctctgatacaa 22822436  T
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||| | |||||||| ||||| |||||| |||||||| || ||||| | |||||||| |||| ||||||||||||    
22822435 tcttagaatttgtggttggacctaatacaaccgcacaaaaccggcttgtgtggtgaggatt-tcccccacttataaaca 22822358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 70; E-Value: 4e-31
Query Start/End: Original strand, 586 - 727
Target Start/End: Original strand, 36686065 - 36686206
Alignment:
586 ataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaa 685  Q
    |||||||||||||||||||||||||||||||||||||||||| ||||| || ||||||||||| |||  |||  |||||| || || ||||||||| |||    
36686065 ataaatggtgggtggcccgatagcggaaacctgatagcaggtggcccattgaatcttgaagaggctcttatactatcttaaaaatcatggttgggcataa 36686164  T
686 cacaaccccacaaaactggtttgtgagatgaggattgtccct 727  Q
    ||||| |||||||||  |||||||| ||||| |||| |||||    
36686165 cacaatcccacaaaataggtttgtgggatgaagattatccct 36686206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 68; E-Value: 6e-30
Query Start/End: Original strand, 526 - 739
Target Start/End: Complemental strand, 7926543 - 7926336
Alignment:
526 cgatgtgggacgctt-aatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagca 624  Q
    ||||||||||| ||| || ||||| |||||| || | || |||||| |||||||||||||      || |||||||||| |||| |||||||||||||||    
7926543 cgatgtgggactctttaacacaccccctcacgactaccattattgggcttggttcgtgga------tgatgggtggccctatagtggaaacctgatagca 7926450  T
625 ggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtc 724  Q
    ||| ||||||||||||||| |||| ||| |||| |||||| ||| || ||||||||||||||||| ||||||||||| || |||||   |||||| || |    
7926449 ggtggcccaatggatcttggagaggctctgataccatcttcgaaatcttggttgggcctaacacagccccacaaaaccggcttgtgttgtgaggaatg-c 7926351  T
725 cctcacttataaaca 739  Q
    || ||||||||||||    
7926350 ccccacttataaaca 7926336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 68; E-Value: 6e-30
Query Start/End: Original strand, 586 - 737
Target Start/End: Original strand, 12869187 - 12869337
Alignment:
586 ataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaa 685  Q
    |||||||  ||||| ||||||| ||||||||||||| ||||| | ||||   ||| ||||||||||| |||| |||||||||| ||||||||||||||||    
12869187 ataaatgacgggtgacccgataacggaaacctgataacaggtgggccaaaaaatcgtgaagagactctgataccatcttagaaatcgtggttgggcctaa 12869286  T
686 cacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaa 737  Q
    |||||||||||||||| |  || |||| ||||||||||||| ||||||||||    
12869287 cacaaccccacaaaaccgtcttatgaggtgaggattgtccc-cacttataaa 12869337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 560 - 722
Target Start/End: Original strand, 6666533 - 6666695
Alignment:
560 agcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatc 659  Q
    ||||||||||| |||||| | |||| |||||||||||||| ||||||||  ||| ||| ||||||||| ||||||  ||||||| ||||  ||  ||| |    
6666533 agcactattgggcttggtgcatggatataaatggtgggtgacccgatagaagaatccttatagcaggtggcccaacagatcttgtagaggttctaatacc 6666632  T
660 atcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattg 722  Q
    ||||||||| |||||||||||||||| |||| |||||||||| |||||||||| | |||||||    
6666633 atcttagaaatcgtggttgggcctaaaacaatcccacaaaaccggtttgtgaggtaaggattg 6666695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 66; E-Value: 1e-28
Query Start/End: Original strand, 586 - 739
Target Start/End: Complemental strand, 9685558 - 9685406
Alignment:
586 ataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaa 685  Q
    |||||||  ||||||||||||| ||||||||||||| ||||| |||||| | ||  ||||||| ||| |||| ||| |||||| ||||||||||||||||    
9685558 ataaatgacgggtggcccgataacggaaacctgataacaggtggcccaaagaattgtgaagaggctctgataccatattagaaatcgtggttgggcctaa 9685459  T
686 cacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    ||||||| |||||||| |  ||||||| ||||||||| ||| ||||||||||||    
9685458 cacaacctcacaaaaccgacttgtgaggtgaggattggccc-cacttataaaca 9685406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 66; E-Value: 1e-28
Query Start/End: Original strand, 550 - 727
Target Start/End: Original strand, 21646390 - 21646566
Alignment:
550 cctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagaga 649  Q
    |||||| |||| |||||||||||||||||| |||| ||||||||||| ||| ||||||| | |||| |||||||||||  ||||||| |||||| |||||    
21646390 cctcacgaccaacactattggacttggttcatggacataaatggtgg-tggtccgatagtgaaaacatgatagcaggtgacccaatgaatcttggagaga 21646488  T
650 ctcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccct 727  Q
    |||  ||| ||||||| || |||||||||||||||| | | ||||| ||||| |  |||| || ||||||||||||||    
21646489 ctctaataccatcttaaaaatcgtggttgggcctaatagagccccataaaaccgacttgtaaggtgaggattgtccct 21646566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 66; E-Value: 1e-28
Query Start/End: Original strand, 598 - 739
Target Start/End: Original strand, 34357966 - 34358106
Alignment:
598 tggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccaca 697  Q
    |||||||||||||||||||||||| || || ||||||| ||||||| |||| ||| ||||||||||||||| ||||| ||| ||||||||||||||||||    
34357966 tggcccgatagcggaaacctgataacaagtggcccaatagatcttgtagaggctctgatatcatcttagaaatcgtgtttgagcctaacacaaccccaca 34358065  T
698 aaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||| || || |||  ||||||||| ||| || |||||||||    
34358066 aaaccggcttctgatgtgaggattg-cccccatttataaaca 34358106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 526 - 657
Target Start/End: Original strand, 27634180 - 27634311
Alignment:
526 cgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcag 625  Q
    ||||||||||| ||||| || || |||||| |||||||||||||| ||||||||||||| |||||  |||||||| |||||||| ||||||||||||||     
27634180 cgatgtgggactcttaacaccccccctcacgaccagcactattgggcttggttcgtggacataaacagtgggtggtccgatagcagaaacctgatagcaa 27634279  T
626 gtagcccaatggatcttgaagagactcagata 657  Q
    || | ||||||||||||| |||| ||| ||||    
27634280 gtggtccaatggatcttggagaggctctgata 27634311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 63; E-Value: 6e-27
Query Start/End: Original strand, 601 - 739
Target Start/End: Complemental strand, 1518309 - 1518172
Alignment:
601 cccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaa 700  Q
    ||||||| || |||||||||| ||||| |||||| | ||| |||| || ||| |||| |||||||||| |||||||| ||||||||||||||||||||||    
1518309 cccgataacgtaaacctgataacaggtggcccaaagaatcgtgaaaaggctctgataccatcttagaaatcgtggttaggcctaacacaaccccacaaaa 1518210  T
701 ctggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    | || ||||||| ||||||||| ||| ||||||||||||    
1518209 ccggcttgtgagctgaggattg-cccccacttataaaca 1518172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 63; E-Value: 6e-27
Query Start/End: Original strand, 573 - 739
Target Start/End: Complemental strand, 22445625 - 22445459
Alignment:
573 ttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcg 672  Q
    |||||||||||| ||||| ||||||| | ||||||| | || ||| |||| |||| || ||||||||||||||||| ||| |||| |||||||||| | |    
22445625 ttggttcgtggacataaacggtgggtagtccgatagtgtaatcctaatagtaggtggctcaatggatcttgaagaggctctgataccatcttagaatttg 22445526  T
673 tggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||| |||||||||||||||||||| |  ||||  | ||||||||| ||| |||| |||||||    
22445525 tggttgggtctaacacaaccccacaaaaccgacttgtagggtgaggattgccccccactaataaaca 22445459  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 586 - 739
Target Start/End: Original strand, 14783111 - 14783263
Alignment:
586 ataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaa 685  Q
    |||||||  ||||||||||||| || |||||||||| ||||| |||||| | ||  ||||||| ||| |||| ||| |||||| ||||||||||||||||    
14783111 ataaatgacgggtggcccgataacgaaaacctgataacaggtggcccaaagaattgtgaagaggctctgataccatattagaaatcgtggttgggcctaa 14783210  T
686 cacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||||||||||| || ||||||| ||| ||||| ||| || |||||||||    
14783211 cacaaccccacaaaaccggcttgtgaggtgatgattg-cccacagttataaaca 14783263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 586 - 739
Target Start/End: Original strand, 53814853 - 53815005
Alignment:
586 ataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaa 685  Q
    |||||||  ||||| ||||||| | ||||||||||| ||||| |||||| | ||| ||||||| ||| |||| ||| |||||| |||||||||||| |||    
53814853 ataaatgacgggtgacccgataacagaaacctgataacaggtggcccaaagaatcgtgaagaggctctgataccatattagaaatcgtggttgggcttaa 53814952  T
686 cacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||||||||||| |  ||||||| ||||||||| ||| ||||||||||||    
53814953 cacaaccccacaaaaccgacttgtgaggtgaggattg-cccccacttataaaca 53815005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 61; E-Value: 9e-26
Query Start/End: Original strand, 539 - 643
Target Start/End: Original strand, 25324146 - 25324250
Alignment:
539 ttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatgga 638  Q
    |||| ||||| ||||||| |||  |||||||| |||||| ||| || |||||||||||||||||||||||||||||| ||||||||||| ||||||||||    
25324146 ttaacacaccccctcacacccaatactattgggcttggtgcgtagatataaatggtgggtggcccgatagcggaaacttgatagcaggtggcccaatgga 25324245  T
639 tcttg 643  Q
    |||||    
25324246 tcttg 25324250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 61; E-Value: 9e-26
Query Start/End: Original strand, 544 - 722
Target Start/End: Original strand, 35645282 - 35645457
Alignment:
544 acaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttg 643  Q
    ||||| |||||| |||||||| |||||  |||||||||||| |||||||| ||||||||||||||||||||| |||||||| || |||| ||||||| |     
35645282 acaccccctcacgaccagcacaattgggtttggttcgtggacataaatggcgggtggcccgatagcggaaacttgatagcatgtggccccatggatcgtt 35645381  T
644 aagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattg 722  Q
     |||| ||| |||| ||| ||||    ||||||||||| |||||||||| || |||||||| || |||| ||| |||||    
35645382 gagaggctctgataccatgttag---ccgtggttgggcttaacacaacctcataaaactggcttctgaggtgatgattg 35645457  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 58; E-Value: 6e-24
Query Start/End: Original strand, 539 - 739
Target Start/End: Complemental strand, 33108078 - 33107878
Alignment:
539 ttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatgga 638  Q
    ||||||||||| ||||| |||| || ||||| | |||||| ||||| ||||||||||||||| |||||| ||||||||| ||||||||| |||||||| |    
33108078 ttaatacaccatctcacgaccaacattattgtatttggttagtggacataaatggtgggtggtccgataacggaaaccttatagcaggtggcccaatgaa 33107979  T
639 tcttgaagaga-ctcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaa 737  Q
    | ||||||  | ||  |||| ||| ||| || |||||||||||  ||||| || || |||||||| | ||||||| ||| ||||||| | ||||||||||    
33107978 ttttgaaggaagctttgataccatattaaaaatcgtggttgggtttaacataatcctacaaaacttgcttgtgaggtgaagattgtctc-cacttataaa 33107880  T
738 ca 739  Q
    ||    
33107879 ca 33107878  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 58; E-Value: 6e-24
Query Start/End: Original strand, 586 - 739
Target Start/End: Original strand, 53828447 - 53828599
Alignment:
586 ataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaa 685  Q
    |||||||  ||||||||||||| |||||||||||||  |||| |||||| | ||| | || || ||| |||| |||||||||| | ||||||||||||||    
53828447 ataaatgacgggtggcccgataacggaaacctgataataggtggcccaaagaatcgttaaaaggctctgataccatcttagaaattgtggttgggcctaa 53828546  T
686 cacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||||||||||  || || |||| ||||||||| ||| ||||||||||||    
53828547 cacaaccccacaaaatcggcttatgaggtgaggattg-cccccacttataaaca 53828599  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #31
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 528 - 648
Target Start/End: Original strand, 5398312 - 5398431
Alignment:
528 atgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggt 627  Q
    ||||||||| ||||| ||||| |||||| |||| || |||||| ||||||||||||| ||||||||||||||| ||||||| |||||||||||||||| |    
5398312 atgtgggactcttaacacacc-cctcacgaccaacattattgggcttggttcgtggacataaatggtgggtggtccgataggggaaacctgatagcagat 5398410  T
628 agcccaatggatcttgaagag 648  Q
      |||| ||||||||| ||||    
5398411 gacccattggatcttggagag 5398431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #32
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 544 - 722
Target Start/End: Original strand, 35645571 - 35645746
Alignment:
544 acaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttg 643  Q
    ||||| |||||| |||||||| |||||  |||||||||||| |||||||| ||||||||||||||||||||| |||||||| || |||| ||||||| |     
35645571 acaccccctcacgaccagcacaattgggtttggttcgtggacataaatggcgggtggcccgatagcggaaacttgatagcatgtggccccatggatcgtt 35645670  T
644 aagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattg 722  Q
     |||| ||| |||| ||| ||||    ||||||||||| |||||||||| || ||||| || || |||| ||| |||||    
35645671 gagaggctctgataccatgttag---ccgtggttgggcttaacacaacctcataaaaccggcttctgaggtgatgattg 35645746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #33
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 590 - 700
Target Start/End: Complemental strand, 4464452 - 4464341
Alignment:
590 atggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaa-gagactcagatatcatcttagaactcgtggttgggcctaacac 688  Q
    |||||||||| | ||||| |||||||||||||||| ||  |||||||||||||||| ||| ||| |||| |||||||||| ||||||||||| ||||||     
4464452 atggtgggtgactcgataacggaaacctgatagcatgtgacccaatggatcttgaaggaggctctgataccatcttagaattcgtggttgggtctaacaa 4464353  T
689 aaccccacaaaa 700  Q
    ||||||||||||    
4464352 aaccccacaaaa 4464341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #34
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 526 - 717
Target Start/End: Original strand, 21750141 - 21750332
Alignment:
526 cgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcag 625  Q
    ||||||| |||  |||| ||||| |||||| ||||| | ||||||| |||||||||||| ||||| ||||| || |||  | ||||||| | |||||||     
21750141 cgatgtgagacttttaacacaccccctcacgaccagtattattggatttggttcgtggacataaacggtggatgacccatttgcggaaatcagatagcat 21750240  T
626 gtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgag 717  Q
    ||   |||||| || || ||||| ||| |||| ||||||| || ||||| ||||| ||||||||||| ||||||||||||||||||| ||||    
21750241 gtgatccaatgaattttaaagaggctctgataccatcttaaaattcgtgattgggtctaacacaacctcacaaaactggtttgtgaggtgag 21750332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #35
Raw Score: 55; E-Value: 4e-22
Query Start/End: Original strand, 526 - 624
Target Start/End: Original strand, 6778542 - 6778640
Alignment:
526 cgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagca 624  Q
    ||||||||||| ||||| ||||| |||||| | |||||||||| |  ||||||||| || |||||||| ||||||||||||||||||||||||||||||    
6778542 cgatgtgggactcttaacacaccccctcacgatcagcactattaggtttggttcgtagacataaatggggggtggcccgatagcggaaacctgatagca 6778640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #36
Raw Score: 55; E-Value: 4e-22
Query Start/End: Original strand, 586 - 699
Target Start/End: Original strand, 40716544 - 40716658
Alignment:
586 ataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatc-ttgaagagactcagatatcatcttagaactcgtggttgggccta 684  Q
    |||||||  ||||||||||||| ||||||||||||||||||| |||||| ||||| | || ||| ||| |||| ||||||||||  | ||||||||||||    
40716544 ataaatgacgggtggcccgataacggaaacctgatagcaggtggcccaacggatcgtggatgaggctctgataccatcttagaaaccatggttgggccta 40716643  T
685 acacaaccccacaaa 699  Q
    |||||||||||||||    
40716644 acacaaccccacaaa 40716658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #37
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 526 - 692
Target Start/End: Original strand, 13555346 - 13555507
Alignment:
526 cgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcag 625  Q
    |||||||| || ||||| || || |||||| | || ||||||||| |||||||||||| | ||||| ||||||||||    |||||||||||||||||||    
13555346 cgatgtggaactcttaacaccccccctcacgatcaacactattgggcttggttcgtggca-taaatcgtgggtggcc----agcggaaacctgatagcag 13555440  T
626 gtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaacc 692  Q
    || | ||||||||||||| |||| ||| |||| ||| | |||| | |||||||||||||||| ||||    
13555441 gtggtccaatggatcttggagaggctctgataccatatcagaaattgtggttgggcctaacaaaacc 13555507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #38
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 550 - 721
Target Start/End: Complemental strand, 43743180 - 43743014
Alignment:
550 cctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagaga 649  Q
    |||||||||||||| ||||||  |||||||||||| ||||||| || ||| || ||||     ||||||||||||||| | | ||||||||||  ||||     
43743180 cctcacaaccagcattattgggtttggttcgtggacataaatgatgagtgacctgata-----aacctgatagcaggtggtcaaatggatctttgagagg 43743086  T
650 ctcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggatt 721  Q
    ||| ||||  |||||| || |||||||| || |||||| ||||||| |||||||| ||||||| ||||||||    
43743085 ctctgatactatcttataaatcgtggttaggtctaacataaccccaaaaaactggcttgtgagttgaggatt 43743014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #39
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 633 - 738
Target Start/End: Complemental strand, 17111676 - 17111573
Alignment:
633 aatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcactt 732  Q
    ||||||||||| | |||||| |||| |||||||||| ||||||||||||||||||||||||||||||||  |||| | || |||||||||  || |||||    
17111676 aatggatcttggaaagactctgataccatcttagaaatcgtggttgggcctaacacaaccccacaaaaccagtttttaaggtgaggattg--ccccactt 17111579  T
733 ataaac 738  Q
    ||||||    
17111578 ataaac 17111573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #40
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 590 - 692
Target Start/End: Original strand, 30530090 - 30530192
Alignment:
590 atggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacaca 689  Q
    |||||||||| | |||||||||||| |||||||||||| ||| ||||||||||| |||| ||| |||| |||||||||| | ||||||| |||||||| |    
30530090 atggtgggtgacgcgatagcggaaatctgatagcaggtggcctaatggatcttggagaggctctgataccatcttagaaattgtggttgagcctaacata 30530189  T
690 acc 692  Q
    |||    
30530190 acc 30530192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #41
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 527 - 699
Target Start/End: Complemental strand, 23210060 - 23209888
Alignment:
527 gatgtgggacgctt-aatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcag 625  Q
    |||||||||| ||| |||||||| | |||||||||| || ||||   |||||| ||||| |||| |||||| || | |||||||| ||||  ||||||||    
23210060 gatgtgggactctttaatacaccccttcacaaccagaacaattgagtttggtttgtggacataattggtggatgactcgatagcgaaaacg-gatagcag 23209962  T
626 gtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaa 699  Q
     ||| |||||| |||||| ||||| |  ||||||||||||||| ||||| ||||||||||| |||||| |||||    
23209961 atagaccaatgtatcttggagagattttgatatcatcttagaaatcgtgattgggcctaactcaaccctacaaa 23209888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #42
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 586 - 739
Target Start/End: Original strand, 54054962 - 54055108
Alignment:
586 ataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaa 685  Q
    |||||||  ||||||||||||| ||||||||||||| ||||| ||||||   ||| ||||||| ||| |||| ||| ||||||  |||||||||||||||    
54054962 ataaatgacgggtggcccgataacggaaacctgataacaggtggcccaaaaaatcgtgaagaggctctgataccatattagaaagcgtggttgggcctaa 54055061  T
686 cacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    ||     ||||||||| || ||||||||||||||||| ||| ||||||||||||    
54055062 ca-----ccacaaaac-ggcttgtgagatgaggattg-cccccacttataaaca 54055108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #43
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 663 - 739
Target Start/End: Complemental strand, 21498878 - 21498803
Alignment:
663 ttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||| |||||||||||||||||||||||||||||||| || ||||||| ||||||||| ||| ||||||||||||    
21498878 ttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattg-cccccacttataaaca 21498803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #44
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 436 - 516
Target Start/End: Complemental strand, 22827626 - 22827546
Alignment:
436 aagtcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    ||||||||||| |||| ||||| | ||||||||||| |||||||||| ||||||| || ||||||||||||||||||||||    
22827626 aagtcttagaaatcgtggttgggcctaacacaacccgacaaaaccggcttgtgaggtgaggattgcccccacttataaaca 22827546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #45
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 550 - 739
Target Start/End: Complemental strand, 31945118 - 31944929
Alignment:
550 cctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagaga 649  Q
    |||||| || ||| |||||||  |||||| || || ||||||||| ||||| |||||||| ||||||| |||||| || | | ||| ||||||| |||||    
31945118 cctcacgactagccctattgggtttggtttgtagacataaatggtaggtggtccgatagcagaaacctaatagcatgtggtc-aatagatcttggagaga 31945020  T
650 ctcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactg--gtttgtgagatgaggattgtccctcacttataaaca 739  Q
    ||| ||| |||| |||||| | ||  ||||||||| ||||| ||||||||||||  | ||||||||||| ||||||| | ||||||||||||    
31945019 ctctgatgtcattttagaaattgtatttgggcctatcacaatcccacaaaactgcagcttgtgagatgaagattgtctc-cacttataaaca 31944929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #46
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 441 - 516
Target Start/End: Complemental strand, 21498878 - 21498803
Alignment:
441 ttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||| |||| ||||| | |||||||||||||||||||||| ||||||| || ||||||||||||||||||||||    
21498878 ttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaaca 21498803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #47
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 590 - 771
Target Start/End: Original strand, 24513287 - 24513468
Alignment:
590 atggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatctt-gaagagactcagatatcatcttagaactcgtggttgggcctaacac 688  Q
    |||||||||| || ||||||||||  |||||||||| | | ||||| |||||| || ||| ||| |||||||| |||||| ||||| |||||||||||||    
24513287 atggtgggtgacctgatagcggaagtctgatagcagatggtccaatagatcttagaggaggctctgatatcatgttagaaatcgtgattgggcctaacac 24513386  T
689 aaccccacaaaactggtttgtgagatgaggattgtccctcacttata-aacatctcatttccgatgtgagattcttaacaatta 771  Q
    ||||| || |||| || ||||||| ||||||||| ||| ||||||||   |||||  | |||||||||||| | ||||||||||    
24513387 aaccctac-aaaccggcttgtgaggtgaggattg-cccccacttataggccatcttttgtccgatgtgagacttttaacaatta 24513468  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #48
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 441 - 516
Target Start/End: Original strand, 53814930 - 53815005
Alignment:
441 ttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||| |||| ||||| |||||||||||||||||||||||  ||||||| || ||||||||||||||||||||||    
53814930 ttagaaatcgtggttgggcttaacacaaccccacaaaaccgacttgtgaggtgaggattgcccccacttataaaca 53815005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #49
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 661 - 739
Target Start/End: Original strand, 22231072 - 22231149
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||| |||||||||| ||||| ||||||||||||||| || ||||||| ||||||||||||| ||||||||||||    
22231072 tcttagaaatcgtggttggacctaatacaaccccacaaaaccggcttgtgaggtgaggattgtccc-cacttataaaca 22231149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #50
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 661 - 739
Target Start/End: Complemental strand, 22827623 - 22827546
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||| |||||||||||||||||||||||| ||||||| || ||||||| ||||||||| ||| ||||||||||||    
22827623 tcttagaaatcgtggttgggcctaacacaacccgacaaaaccggcttgtgaggtgaggattg-cccccacttataaaca 22827546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #51
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 661 - 739
Target Start/End: Original strand, 22845446 - 22845523
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||| |||||||||||||||||||||||||||||||| || ||||||| ||||||||  ||| ||||||||||||    
22845446 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggatt-acccccacttataaaca 22845523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #52
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 661 - 739
Target Start/End: Complemental strand, 22863559 - 22863482
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||| |||||||||||||||||||||||||||||||| || ||||| | ||||||||| ||| ||||||||||||    
22863559 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtggggtgaggattg-cccccacttataaaca 22863482  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #53
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 439 - 516
Target Start/End: Complemental strand, 1518249 - 1518172
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| |||| ||| | | |||||||||||||||||||||| ||||||| || ||||||||||||||||||||||    
1518249 tcttagaaatcgtggttaggcctaacacaaccccacaaaaccggcttgtgagctgaggattgcccccacttataaaca 1518172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #54
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 671 - 728
Target Start/End: Original strand, 5398221 - 5398278
Alignment:
671 cgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctc 728  Q
    ||||||||||||||||||||||||||||||| || ||||||||||||||||| |||||    
5398221 cgtggttgggcctaacacaaccccacaaaaccggcttgtgagatgaggattgcccctc 5398278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #55
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 654 - 739
Target Start/End: Complemental strand, 21498446 - 21498362
Alignment:
654 gatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||| ||| |||||| |||||||||||||||||| ||||||||||||| || ||||||| ||||||||| ||| ||||||||||||    
21498446 gataccatattagaaatcgtggttgggcctaacataaccccacaaaaccggcttgtgaggtgaggattg-cccccacttataaaca 21498362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #56
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 439 - 516
Target Start/End: Original strand, 22845446 - 22845523
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| |||| ||||| | |||||||||||||||||||||| ||||||| || ||||| ||||||||||||||||    
22845446 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattacccccacttataaaca 22845523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #57
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 439 - 516
Target Start/End: Complemental strand, 22863559 - 22863482
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| |||| ||||| | |||||||||||||||||||||| ||||| | || ||||||||||||||||||||||    
22863559 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtggggtgaggattgcccccacttataaaca 22863482  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #58
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 562 - 722
Target Start/End: Complemental strand, 41853559 - 41853398
Alignment:
562 cactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaa-gagactcagatatca 660  Q
    ||||||||| |||||| || ||| ||||||| ||||||| |||||| ||| |||  || ||||||| |||||| |||||||||  | | |||||||| ||    
41853559 cactattgggcttggtgcgaggatataaatgatgggtggtccgataacggcaactcgaaagcaggtggcccaacggatcttgagtggggctcagatacca 41853460  T
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattg 722  Q
    | ||| || ||||| ||| ||||||||||||| ||||||||| | ||||||| ||| |||||    
41853459 ttttaaaaatcgtgattgagcctaacacaacctcacaaaactagcttgtgaggtgaagattg 41853398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #59
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 654 - 735
Target Start/End: Original strand, 50543322 - 50543402
Alignment:
654 gatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttata 735  Q
    |||| |||||||||| |||||||||||||||||||||||||||||||| || ||||| | ||||||||| ||| ||||||||    
50543322 gataacatcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtggggtgaggattg-cccccacttata 50543402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #60
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 663 - 739
Target Start/End: Complemental strand, 9685715 - 9685640
Alignment:
663 ttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||| |||||||||||||||||||||||||| ||||| || ||||||| ||||||||| ||| ||||||||||||    
9685715 ttagaaatcgtggttgggcctaacacaaccccataaaaccggcttgtgaggtgaggattg-cccccacttataaaca 9685640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #61
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 663 - 739
Target Start/End: Original strand, 28245527 - 28245602
Alignment:
663 ttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||| |||| ||||||||||||||||||||||||||| || ||||||| ||||||||| ||| ||||||||||||    
28245527 ttagaaatcgtagttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattg-cccccacttataaaca 28245602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #62
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 663 - 739
Target Start/End: Original strand, 53814675 - 53814750
Alignment:
663 ttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||| ||||||||||||||||||||| |||||||||| || ||||||| |||||||| |||| ||||||||||||    
53814675 ttagaaatcgtggttgggcctaacacaatcccacaaaaccggcttgtgaggtgaggattatccc-cacttataaaca 53814750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #63
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 441 - 516
Target Start/End: Complemental strand, 9685715 - 9685640
Alignment:
441 ttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||| |||| ||||| | ||||||||||||| |||||||| ||||||| || ||||||||||||||||||||||    
9685715 ttagaaatcgtggttgggcctaacacaaccccataaaaccggcttgtgaggtgaggattgcccccacttataaaca 9685640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #64
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 441 - 516
Target Start/End: Complemental strand, 21498437 - 21498362
Alignment:
441 ttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||| |||| ||||| | ||||| |||||||||||||||| ||||||| || ||||||||||||||||||||||    
21498437 ttagaaatcgtggttgggcctaacataaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaaca 21498362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #65
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 441 - 516
Target Start/End: Complemental strand, 25052935 - 25052860
Alignment:
441 ttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||| |||| ||||| | |||||||||||||||||||||| ||||||| || ||||| ||||||||||||||||    
25052935 ttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgcggattacccccacttataaaca 25052860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #66
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 550 - 643
Target Start/End: Original strand, 12005594 - 12005690
Alignment:
550 cctcacaaccagcactattggacttg---gttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttg 643  Q
    |||||| |||||||||||||| ||||   |||||| || |||||||||| |||||| ||||||||||||||||||| ||||  |||| |||||||||    
12005594 cctcacgaccagcactattgggcttgttggttcgttgacataaatggtgtgtggcctgatagcggaaacctgatagtaggtgacccagtggatcttg 12005690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #67
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 438 - 516
Target Start/End: Original strand, 39902561 - 39902639
Alignment:
438 gtcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    ||||||||| | || ||||| | |||||||||||||||||||| | ||||||| || ||||||||||||||||||||||    
39902561 gtcttagaaatggtggttgggcctaacacaaccccacaaaaccagcttgtgaggtgaggattgcccccacttataaaca 39902639  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #68
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 661 - 739
Target Start/End: Original strand, 39902562 - 39902639
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||| | ||||||||||||||||||||||||||||||  | ||||||| ||||||||| ||| ||||||||||||    
39902562 tcttagaaatggtggttgggcctaacacaaccccacaaaaccagcttgtgaggtgaggattg-cccccacttataaaca 39902639  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #69
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 439 - 516
Target Start/End: Original strand, 12869028 - 12869105
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| ||||||||   | |||||||||||||||||||||| ||||||| ||  |||||||||||||||||||||    
12869028 tcttagaaatcgtagtttagcctaacacaaccccacaaaaccggcttgtgaggtgatgattgcccccacttataaaca 12869105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #70
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 586 - 722
Target Start/End: Original strand, 18528375 - 18528517
Alignment:
586 ataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttg-------aagagactcagatatcatcttagaactcgtggttg 678  Q
    ||||||||||||||||| |||||||||| ||||||| ||||| ||||||  |||||||       | ||| ||| |||| |||||||||| |||||||||    
18528375 ataaatggtgggtggcc-gatagcggaagcctgataacaggtggcccaacagatcttggtcttgaaggaggctctgataccatcttagaaatcgtggttg 18528473  T
679 ggcctaacacaaccccacaaaactggtttgtgagatgaggattg 722  Q
    || |||||| || | |||||||| | |||||||| |||||||||    
18528474 ggtctaacaaaatctcacaaaaccgatttgtgaggtgaggattg 18528517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #71
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 654 - 739
Target Start/End: Complemental strand, 25052944 - 25052860
Alignment:
654 gatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||| ||| |||||| |||||||||||||||||||||||||||||||| || ||||||| || |||||  ||| ||||||||||||    
25052944 gataccatgttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgcggatt-acccccacttataaaca 25052860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #72
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 654 - 739
Target Start/End: Original strand, 35609703 - 35609787
Alignment:
654 gatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||| |||||||||| || |||||||| || ||||||||||||||||| || ||||||| ||||||||| ||| ||||||||||||    
35609703 gataccatcttagaaatcatggttgggtcttacacaaccccacaaaaccggcttgtgaggtgaggattggccc-cacttataaaca 35609787  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #73
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 439 - 516
Target Start/End: Original strand, 40717440 - 40717517
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| |||| ||||| | |||||||||||||||||||||  || |||| || ||||||||||||||||||||||    
40717440 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccgacttttgaggtgaggattgcccccacttataaaca 40717517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #74
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 439 - 516
Target Start/End: Complemental strand, 52559652 - 52559575
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| || | ||||| | |||||||||||||||||||||| ||||||| ||  |||||||||||||||||||||    
52559652 tcttagaaatcatggttgggcctaacacaaccccacaaaaccggcttgtgaggtgatgattgcccccacttataaaca 52559575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #75
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 658 - 722
Target Start/End: Original strand, 5398472 - 5398536
Alignment:
658 tcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattg 722  Q
    ||||||||||| || ||||||| ||||||||||||||||||||| || ||||||| |||||||||    
5398472 tcatcttagaaatcatggttggacctaacacaaccccacaaaaccggcttgtgaggtgaggattg 5398536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #76
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 432 - 516
Target Start/End: Complemental strand, 16066157 - 16066073
Alignment:
432 ttctaagtcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| |||||| | || ||||| | |||||||| || |||||||| ||||||||| || ||||||||||||||||||||||    
16066157 ttctaagtattagaaatggtggttgggcctaacacaatcctacaaaaccagtttgtgaggtgaggattgcccccacttataaaca 16066073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #77
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 663 - 739
Target Start/End: Complemental strand, 20822056 - 20821981
Alignment:
663 ttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||| ||||||||||||||||||||| |||||||||| || ||||||| |||| |||| ||| ||||||||||||    
20822056 ttagaaatcgtggttgggcctaacacaatcccacaaaaccggcttgtgaggtgagaattg-cccccacttataaaca 20821981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #78
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 612 - 739
Target Start/End: Complemental strand, 5846280 - 5846154
Alignment:
612 aaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtga 711  Q
    |||| ||||| ||||| |||||| | ||| |||||||  |  |||| ||| |||||| ||||||||| ||||||| |||||||||||||| || || |||    
5846280 aaacttgataacaggtggcccaaagaatcgtgaagaggttttgataccatattagaaatcgtggttgagcctaacgcaaccccacaaaaccggcttatga 5846181  T
712 gatgaggattgtccctcacttataaaca 739  Q
    | ||||||||| ||| ||||||||||||    
5846180 ggtgaggattg-cccccacttataaaca 5846154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #79
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 461 - 516
Target Start/End: Original strand, 6666221 - 6666276
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||||||||||||||| ||||||||| || |||||||||||| |||||||||    
6666221 taacacaaccccacaaaacctgtttgtgaggtgaggattgcccccaattataaaca 6666276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #80
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 441 - 516
Target Start/End: Complemental strand, 20822056 - 20821981
Alignment:
441 ttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||| |||| ||||| | |||||||| ||||||||||||| ||||||| || | ||||||||||||||||||||    
20822056 ttagaaatcgtggttgggcctaacacaatcccacaaaaccggcttgtgaggtgagaattgcccccacttataaaca 20821981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #81
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 465 - 516
Target Start/End: Original strand, 28246110 - 28246161
Alignment:
465 acaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||||||||||||| ||||||| || ||||||||||||||||||||||    
28246110 acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaaca 28246161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #82
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 594 - 704
Target Start/End: Original strand, 30565965 - 30566076
Alignment:
594 tgggtggcccgatagcggaaacctgatagcaggtagcccaatggatctt-gaagagactcagatatcatcttagaactcgtggttgggcctaacacaacc 692  Q
    |||||||||||||||| ||||| |||||||| || | |||||||||||| || ||| |||  ||| ||||| ||||  ||||||||||| |||||||| |    
30565965 tgggtggcccgatagccgaaacttgatagcaagtggtccaatggatcttagaggaggctctcataccatctaagaaaacgtggttgggcttaacacaaac 30566064  T
693 ccacaaaactgg 704  Q
    | ||||||||||    
30566065 ctacaaaactgg 30566076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #83
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 659 - 734
Target Start/End: Complemental strand, 40726808 - 40726734
Alignment:
659 catcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttat 734  Q
    |||||||||| ||||||||||||||||||||| || ||||||| || ||||||| |||||||| |||| |||||||    
40726808 catcttagaaatcgtggttgggcctaacacaatcctacaaaaccggcttgtgaggtgaggatt-tcccccacttat 40726734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #84
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 461 - 516
Target Start/End: Original strand, 53828310 - 53828365
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||||||||||||| |||||| |||| || ||||||||||||||||||||||    
53828310 taacacaaccccacaaaatcggtttatgaggtgaggattgcccccacttataaaca 53828365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #85
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 683 - 737
Target Start/End: Original strand, 2261774 - 2261827
Alignment:
683 taacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaa 737  Q
    ||||||||||||||||||||||| |||||| ||||||||||||| ||||||||||    
2261774 taacacaaccccacaaaactggtctgtgaggtgaggattgtccc-cacttataaa 2261827  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #86
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 672 - 722
Target Start/End: Original strand, 11053891 - 11053941
Alignment:
672 gtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattg 722  Q
    ||||||| || |||||||| |||||||||||||||||||||||||||||||    
11053891 gtggttgagcttaacacaatcccacaaaactggtttgtgagatgaggattg 11053941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #87
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 553 - 611
Target Start/End: Original strand, 20726728 - 20726786
Alignment:
553 cacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcgg 611  Q
    |||| ||| ||||||||| |||||| |||||| ||||||||||||||||||||||||||    
20726728 cacacccaacactattgggcttggtgcgtggatataaatggtgggtggcccgatagcgg 20726786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #88
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 661 - 739
Target Start/End: Original strand, 53828288 - 53828365
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||| | ||| |||||||||||||||||||||||||  ||||| |||| ||||||||| ||| ||||||||||||    
53828288 tcttagaaattgtgattgggcctaacacaaccccacaaaatcggtttatgaggtgaggattg-cccccacttataaaca 53828365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #89
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 459 - 516
Target Start/End: Original strand, 400584 - 400641
Alignment:
459 cttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||||||| ||||||||||| ||||||| || ||||| ||||||||||||||||    
400584 cttaacacaacctcacaaaaccggcttgtgaggtgaggatttcccccacttataaaca 400641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #90
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 453 - 514
Target Start/End: Original strand, 2261766 - 2261827
Alignment:
453 gttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaa 514  Q
    |||| |||||||||||||||||||||| ||| |||||| || |||||| |||||||||||||    
2261766 gttgaacttaacacaaccccacaaaactggtctgtgaggtgaggattgtccccacttataaa 2261827  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #91
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 439 - 516
Target Start/End: Original strand, 5398475 - 5398551
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| || | ||||||| |||||||||||||||||||||| ||||||| || |||||| ||||| |||||||||    
5398475 tcttagaaatcatggttggacctaacacaaccccacaaaaccggcttgtgaggtgaggattg-ccccagttataaaca 5398551  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #92
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 439 - 516
Target Start/End: Original strand, 18528216 - 18528293
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| |||| ||||||  ||||||||||| |||||| || |||||||| || |||||||| |||||||||||||    
18528216 tcttagaaatcgtggttggatctaacacaaccctacaaaatcgatttgtgaggtgaggattgccgccacttataaaca 18528293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #93
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 463 - 516
Target Start/End: Original strand, 35609513 - 35609566
Alignment:
463 acacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||||||||||||||  ||||||| || ||||||||||||||||||||||    
35609513 acacaaccccacaaaaccgacttgtgaggtgaggattgcccccacttataaaca 35609566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #94
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 463 - 516
Target Start/End: Original strand, 35609734 - 35609787
Alignment:
463 acacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||||||||||||||| ||||||| || |||||| |||||||||||||||    
35609734 acacaaccccacaaaaccggcttgtgaggtgaggattggccccacttataaaca 35609787  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #95
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 659 - 720
Target Start/End: Original strand, 36685872 - 36685933
Alignment:
659 catcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggat 720  Q
    |||||||||| ||||||||||| |||| |||||||||||||||||  ||||||| |||||||    
36685872 catcttagaaatcgtggttgggtctaatacaaccccacaaaactgacttgtgaggtgaggat 36685933  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #96
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 661 - 722
Target Start/End: Original strand, 53559289 - 53559350
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattg 722  Q
    |||||||| |||||||||||||||||||||||||||||||  || |||| || |||||||||    
53559289 tcttagaaatcgtggttgggcctaacacaaccccacaaaatcggcttgtaaggtgaggattg 53559350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #97
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 439 - 516
Target Start/End: Original strand, 53828522 - 53828599
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| | || ||||| | |||||||||||||||||| ||| || |||| || ||||||||||||||||||||||    
53828522 tcttagaaattgtggttgggcctaacacaaccccacaaaatcggcttatgaggtgaggattgcccccacttataaaca 53828599  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #98
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 557 - 621
Target Start/End: Complemental strand, 1215944 - 1215880
Alignment:
557 accagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgata 621  Q
    |||| ||||||||||||||||||||||| |||||||||||||  || |||| | |||||||||||    
1215944 accaacactattggacttggttcgtggacataaatggtgggtaacctgatatcagaaacctgata 1215880  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #99
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 612 - 722
Target Start/End: Complemental strand, 8902762 - 8902651
Alignment:
612 aaacctgatagcaggtagcccaatggatcttgaagaga---ctcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttg 708  Q
    |||||||||| ||||| ||||||| ||||||  |||||   ||| |||| |||| ||| | |||||||||| ||||||| |||||||||||||||| |||    
8902762 aaacctgataacaggtggcccaatagatctt--agagaatgctctgataccatcctagcaatcgtggttggacctaacataaccccacaaaactggcttg 8902665  T
709 tgagatgaggattg 722  Q
    ||||  ||||||||    
8902664 tgaggagaggattg 8902651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #100
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 601 - 697
Target Start/End: Original strand, 9908770 - 9908866
Alignment:
601 cccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccaca 697  Q
    ||||||| |||||| |||||||||||| | ||||| ||||||| |||||||| |||| |||||||||  ||||| || || |||| |||||| ||||    
9908770 cccgataacggaaatctgatagcaggtggtccaatagatcttggagagactctgataccatcttagatatcgtgattaggtctaatacaaccacaca 9908866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #101
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 559 - 635
Target Start/End: Original strand, 13495588 - 13495664
Alignment:
559 cagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaat 635  Q
    ||||| |||||| |||| |||||||| ||||||||||| || || |||||| ||||||||||| ||||| |||||||    
13495588 cagcattattgggcttgattcgtggacataaatggtggctgacctgatagccgaaacctgataacaggtggcccaat 13495664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #102
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 663 - 739
Target Start/End: Complemental strand, 16066148 - 16066073
Alignment:
663 ttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||| | ||||||||||||||||||| || |||||||  ||||||||| ||||||||| ||| ||||||||||||    
16066148 ttagaaatggtggttgggcctaacacaatcctacaaaaccagtttgtgaggtgaggattg-cccccacttataaaca 16066073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #103
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 464 - 516
Target Start/End: Original strand, 27464272 - 27464324
Alignment:
464 cacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    ||||||||||||||||||| ||||||| || |||||||| |||||||||||||    
27464272 cacaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaaca 27464324  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #104
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 663 - 739
Target Start/End: Original strand, 54054806 - 54054881
Alignment:
663 ttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||| |||||||||||||||||||||||||||||||  || || |||| |||| |||| ||| ||||||||||||    
54054806 ttagaaatcgtggttgggcctaacacaaccccacaaaaacggcttatgaggtgagaattg-cccccacttataaaca 54054881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #105
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 461 - 512
Target Start/End: Complemental strand, 2463869 - 2463818
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttata 512  Q
    |||||||||||||||||||||| ||||||| |  ||||||||||||||||||    
2463869 taacacaaccccacaaaaccggcttgtgaggtaaggattgcccccacttata 2463818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #106
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 461 - 516
Target Start/End: Original strand, 5398233 - 5398287
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||||||||||||||||| |||||||||| |||||| |||| ||||||||||    
5398233 taacacaaccccacaaaaccggcttgtgagatgaggattg-cccctcttataaaca 5398287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #107
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 461 - 516
Target Start/End: Complemental strand, 5846209 - 5846154
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||| ||||||||||||||||| || |||| || ||||||||||||||||||||||    
5846209 taacgcaaccccacaaaaccggcttatgaggtgaggattgcccccacttataaaca 5846154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #108
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 572 - 627
Target Start/End: Original strand, 7572617 - 7572672
Alignment:
572 cttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggt 627  Q
    |||||| | |||| |||||||||||||||||| |||||||||||||||||| ||||    
7572617 cttggtgcatggatataaatggtgggtggcccaatagcggaaacctgatagaaggt 7572672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #109
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 461 - 516
Target Start/End: Complemental strand, 9279290 - 9279235
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||||||||||||||||| | ||||| ||  |||||||||||||||||||||    
9279290 taacacaaccccacaaaaccggctagtgaggtgatgattgcccccacttataaaca 9279235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #110
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 441 - 516
Target Start/End: Complemental strand, 9685481 - 9685406
Alignment:
441 ttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||| |||| ||||| | |||||||||| ||||||||||  ||||||| || |||||| |||||||||||||||    
9685481 ttagaaatcgtggttgggcctaacacaacctcacaaaaccgacttgtgaggtgaggattggccccacttataaaca 9685406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #111
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 461 - 516
Target Start/End: Original strand, 11036767 - 11036822
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    ||||||||||||||| || ||| ||||||| || ||||||||||||||||||||||    
11036767 taacacaaccccacacaatcggcttgtgaggtgaggattgcccccacttataaaca 11036822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #112
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 439 - 514
Target Start/End: Original strand, 12869262 - 12869337
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaa 514  Q
    |||||||| |||| ||||| | |||||||||||||||||||||  || |||| || |||||| |||||||||||||    
12869262 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccgtcttatgaggtgaggattgtccccacttataaa 12869337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #113
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 441 - 516
Target Start/End: Original strand, 14783188 - 14783263
Alignment:
441 ttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||| |||| ||||| | |||||||||||||||||||||| ||||||| ||  |||||||| || |||||||||    
14783188 ttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgatgattgcccacagttataaaca 14783263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #114
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 437 - 516
Target Start/End: Original strand, 25323795 - 25323874
Alignment:
437 agtcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||||| | ||||||||   ||||||||||||||||||||||  || ||| || ||||||||||||| ||||||||    
25323795 agtcttagaatttgtagttgggactaacacaaccccacaaaaccggcctgcgaggtgaggattgcccccacgtataaaca 25323874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #115
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 579 - 665
Target Start/End: Complemental strand, 26549591 - 26549504
Alignment:
579 cgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatctt-gaagagactcagatatcatctta 665  Q
    |||||| ||||||| ||||||||| |||| | |||||||||||||||||  |||||  |||||| || ||||||| ||||||||||||    
26549591 cgtggacataaatgatgggtggcctgataacagaaacctgatagcaggtgacccaacagatcttagaggagactctgatatcatctta 26549504  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #116
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 676 - 739
Target Start/End: Original strand, 35645779 - 35645841
Alignment:
676 ttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||||||||||||| | |||||||| ||||||| ||||||||| ||| ||||||||||||    
35645779 ttgggcctaacacaaccctaaaaaactggcttgtgaggtgaggattg-cccccacttataaaca 35645841  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #117
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 654 - 737
Target Start/End: Complemental strand, 37836172 - 37836090
Alignment:
654 gatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaa 737  Q
    |||| |||||||||| | |||||| ||||||||||||||||||||||| || |||| ||  |||||||| ||| ||||||||||    
37836172 gataccatcttagaaattgtggttaggcctaacacaaccccacaaaaccggcttgtaaggagaggattg-cccccacttataaa 37836090  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #118
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 461 - 516
Target Start/End: Original strand, 44118880 - 44118935
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    ||||||||||||||||||| || ||||||| || ||||| ||||||||||||||||    
44118880 taacacaaccccacaaaacgggcttgtgaggtgaggattacccccacttataaaca 44118935  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #119
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 441 - 516
Target Start/End: Original strand, 53814675 - 53814750
Alignment:
441 ttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||| |||| ||||| | |||||||| ||||||||||||| ||||||| || |||||  |||||||||||||||    
53814675 ttagaaatcgtggttgggcctaacacaatcccacaaaaccggcttgtgaggtgaggattatccccacttataaaca 53814750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #120
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 441 - 516
Target Start/End: Original strand, 54054806 - 54054881
Alignment:
441 ttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||| |||| ||||| | |||||||||||||||||| ||| || |||| || | ||||||||||||||||||||    
54054806 ttagaaatcgtggttgggcctaacacaaccccacaaaaacggcttatgaggtgagaattgcccccacttataaaca 54054881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #121
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 439 - 509
Target Start/End: Original strand, 6666634 - 6666704
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccactt 509  Q
    |||||||| |||| ||||| | ||| |||| ||||||||||||||||||||| |  |||||||||||||||    
6666634 tcttagaaatcgtggttgggcctaaaacaatcccacaaaaccggtttgtgaggtaaggattgcccccactt 6666704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #122
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 461 - 511
Target Start/End: Original strand, 12005490 - 12005540
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttat 511  Q
    |||||||||| ||||||||||| ||||||| || |||||||||||||||||    
12005490 taacacaacctcacaaaaccggcttgtgaggtgaggattgcccccacttat 12005540  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #123
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 661 - 739
Target Start/End: Original strand, 12869028 - 12869105
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||| |||| |||  |||||||||||||||||||||| || ||||||| ||| ||||| ||| ||||||||||||    
12869028 tcttagaaatcgtagtttagcctaacacaaccccacaaaaccggcttgtgaggtgatgattg-cccccacttataaaca 12869105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #124
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 670 - 740
Target Start/End: Original strand, 13495473 - 13495543
Alignment:
670 tcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaacat 740  Q
    ||||||| || |||||| ||||||| ||||||||  ||||||| ||||||||||||  |||||||||||||    
13495473 tcgtggtcggacctaactcaacccctcaaaactgacttgtgaggtgaggattgtcctccacttataaacat 13495543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #125
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 566 - 700
Target Start/End: Original strand, 25323937 - 25324071
Alignment:
566 attggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatctta 665  Q
    ||||| |||||| |||||| ||||||||||||||  ||||| | |||||||| | || |||| ||||||  ||||||| |||| ||| | || ||| |||    
25323937 attgggcttggtgcgtggatataaatggtgggtgatccgatggtggaaacctaagagtaggtggcccaacagatcttggagaggctctgctaccatatta 25324036  T
666 gaactcgtggttgggcctaacacaaccccacaaaa 700  Q
    ||| || |||||| ||   ||||||||||||||||    
25324037 gaaatcatggttgtgcgctacacaaccccacaaaa 25324071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #126
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 539 - 621
Target Start/End: Complemental strand, 33107841 - 33107759
Alignment:
539 ttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgata 621  Q
    |||| ||||| |||||| ||||  || ||||||||||||||||||| |||| | |||||||   |||||||||||||||||||    
33107841 ttaacacacctcctcacgaccaagaccattggacttggttcgtggacataattagtgggtgaaacgatagcggaaacctgata 33107759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #127
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 661 - 739
Target Start/End: Original strand, 35609489 - 35609566
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||| |||||||||||  | ||||||||||||||||| |  ||||||| ||||||||| ||| ||||||||||||    
35609489 tcttagaaatcgtggttgggtgttacacaaccccacaaaaccgacttgtgaggtgaggattg-cccccacttataaaca 35609566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #128
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 439 - 509
Target Start/End: Original strand, 53559289 - 53559359
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccactt 509  Q
    |||||||| |||| ||||| | |||||||||||||||||| ||| |||| || || |||||||||||||||    
53559289 tcttagaaatcgtggttgggcctaacacaaccccacaaaatcggcttgtaaggtgaggattgcccccactt 53559359  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #129
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 674 - 739
Target Start/End: Complemental strand, 9279299 - 9279235
Alignment:
674 ggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||||||||||||||||||||||| || | ||||| ||| ||||| ||| ||||||||||||    
9279299 ggttgggcctaacacaaccccacaaaaccggctagtgaggtgatgattg-cccccacttataaaca 9279235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #130
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 661 - 726
Target Start/End: Complemental strand, 20095377 - 20095312
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccc 726  Q
    |||||||| || ||| |||| |||||||||||| |||||||||||||||||| ||  |||||||||    
20095377 tcttagaaatcatgggtgggtctaacacaacccaacaaaactggtttgtgaggtggagattgtccc 20095312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #131
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 439 - 516
Target Start/End: Complemental strand, 21685083 - 21685006
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| | || ||||| |||||||||||||||||||| ||| ||||||| || |||||   ||||||||||||||    
21685083 tcttagaaattgtggttgggcttaacacaaccccacaaaatcggcttgtgaggtgaggatttatcccacttataaaca 21685006  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #132
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 439 - 516
Target Start/End: Complemental strand, 22822435 - 22822358
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| | || ||||||| ||| |||||| ||||||||||| ||||| | || ||||| ||||||||||||||||    
22822435 tcttagaatttgtggttggacctaatacaaccgcacaaaaccggcttgtgtggtgaggatttcccccacttataaaca 22822358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #133
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 661 - 718
Target Start/End: Original strand, 28073180 - 28073237
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgagg 718  Q
    |||||||| | ||||||||||||||||||||||||||||||  | ||||||| |||||    
28073180 tcttagaaattgtggttgggcctaacacaaccccacaaaaccagcttgtgaggtgagg 28073237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #134
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 581 - 722
Target Start/End: Complemental strand, 32002487 - 32002347
Alignment:
581 tggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttggg 680  Q
    |||| ||| |||||| ||| | ||||||||||||||||||||||| | | ||||| ||||||| ||||  || |||| ||||||| || | ||| |||||    
32002487 tggacatagatggtgcgtgactcgatagcggaaacctgatagcagat-gaccaatagatcttggagaggttctgataccatcttaaaaattgtgtttggg 32002389  T
681 cctaacacaaccccacaaaactggtttgtgagatgaggattg 722  Q
     |||| |||||| |||||||| | ||||| || ||| |||||    
32002388 tctaatacaacctcacaaaaccgatttgtaaggtgaagattg 32002347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #135
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 461 - 514
Target Start/End: Complemental strand, 37836143 - 37836090
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaa 514  Q
    |||||||||||||||||||||| |||| ||  | ||||||||||||||||||||    
37836143 taacacaaccccacaaaaccggcttgtaaggagaggattgcccccacttataaa 37836090  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #136
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 663 - 735
Target Start/End: Complemental strand, 2463889 - 2463818
Alignment:
663 ttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttata 735  Q
    |||||| | |||| ||||||||||||||||||||||||| || ||||||| | ||||||| ||| ||||||||    
2463889 ttagaaatggtggctgggcctaacacaaccccacaaaaccggcttgtgaggtaaggattg-cccccacttata 2463818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #137
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 461 - 517
Target Start/End: Complemental strand, 6218267 - 6218211
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaacat 517  Q
    ||||||||| |||||||||||  ||||||| ||  ||||||||||||||||||||||    
6218267 taacacaactccacaaaaccgtcttgtgaggtgaagattgcccccacttataaacat 6218211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #138
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 659 - 739
Target Start/End: Original strand, 11036508 - 11036587
Alignment:
659 catcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||||| | ||||||||| ||||||||||||| |||||| || ||||||| ||| ||||| |||  |||||||||||    
11036508 catcttagaaattgtggttgggtctaacacaaccccgcaaaaccggcttgtgaggtgatgattg-ccccaacttataaaca 11036587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #139
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 459 - 503
Target Start/End: Original strand, 11053900 - 11053944
Alignment:
459 cttaacacaaccccacaaaaccggtttgtgagatgtggattgccc 503  Q
    |||||||||| |||||||||| ||||||||||||| |||||||||    
11053900 cttaacacaatcccacaaaactggtttgtgagatgaggattgccc 11053944  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #140
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 439 - 515
Target Start/End: Complemental strand, 17111648 - 17111573
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaac 515  Q
    |||||||| |||| ||||| | |||||||||||||||||||| |||| | || || |||||| ||||||||||||||    
17111648 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccagtttttaaggtgaggattg-ccccacttataaac 17111573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #141
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 661 - 721
Target Start/End: Complemental strand, 21685083 - 21685023
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggatt 721  Q
    |||||||| | |||||||||| ||||||||||||||||||  || ||||||| ||||||||    
21685083 tcttagaaattgtggttgggcttaacacaaccccacaaaatcggcttgtgaggtgaggatt 21685023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #142
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 515 - 603
Target Start/End: Complemental strand, 24974338 - 24974250
Alignment:
515 catcttatattcgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggccc 603  Q
    ||||| |||| ||||||||||| ||||| ||||    |||| || ||| ||||||| |||||||||| || ||||||||||||||||||    
24974338 catctcatatccgatgtgggactcttaacacactctgtcacgactagcgctattgggcttggttcgtagacataaatggtgggtggccc 24974250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #143
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 472 - 516
Target Start/End: Original strand, 31254439 - 31254483
Alignment:
472 cacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||||||||||| || || ||||||||||||||||||||||    
31254439 cacaaaaccggtttgtaaggtgaggattgcccccacttataaaca 31254483  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #144
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 439 - 511
Target Start/End: Complemental strand, 40726806 - 40726734
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttat 511  Q
    |||||||| |||| ||||| | |||||||| || |||||||||| ||||||| || ||||| |||||||||||    
40726806 tcttagaaatcgtggttgggcctaacacaatcctacaaaaccggcttgtgaggtgaggatttcccccacttat 40726734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #145
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 663 - 711
Target Start/End: Complemental strand, 42786521 - 42786473
Alignment:
663 ttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtga 711  Q
    |||||| | |||||||||||||||||||||| |||||||||||| ||||    
42786521 ttagaatttgtggttgggcctaacacaaccctacaaaactggttagtga 42786473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #146
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 661 - 725
Target Start/End: Complemental strand, 43743304 - 43743240
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtcc 725  Q
    |||| ||| ||||| ||||| |||||||||||||||||||| | |||||||| | ||||||||||    
43743304 tcttggaaatcgtgtttgggtctaacacaaccccacaaaaccgatttgtgaggtaaggattgtcc 43743240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #147
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 461 - 517
Target Start/End: Complemental strand, 53699090 - 53699034
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaacat 517  Q
    ||||||||||||| |||  ||||||||||| || ||||||||| |||||||||||||    
53699090 taacacaaccccataaagtcggtttgtgaggtgaggattgcccacacttataaacat 53699034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #148
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 473 - 516
Target Start/End: Complemental strand, 5846430 - 5846387
Alignment:
473 acaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||||| ||||||| || ||||||||||||||||||||||    
5846430 acaaaaccggcttgtgaggtgaggattgcccccacttataaaca 5846387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #149
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 661 - 700
Target Start/End: Complemental strand, 7926643 - 7926604
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaa 700  Q
    |||||||| || ||||||||||||||||||||||||||||    
7926643 tcttagaaatcatggttgggcctaacacaaccccacaaaa 7926604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #150
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 461 - 516
Target Start/End: Original strand, 11036532 - 11036587
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||||||| ||||||||| ||||||| ||  ||||||||| |||||||||||    
11036532 taacacaaccccgcaaaaccggcttgtgaggtgatgattgccccaacttataaaca 11036587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #151
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 461 - 516
Target Start/End: Original strand, 11783813 - 11783868
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    ||||||||||||||||||||  |||||||| || ||||| |||| |||||||||||    
11783813 taacacaaccccacaaaaccaatttgtgaggtgaggattacccctacttataaaca 11783868  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #152
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 660 - 739
Target Start/End: Original strand, 18528215 - 18528293
Alignment:
660 atcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    ||||||||| ||||||||||  |||||||||||| ||||||  | |||||||| ||||||||| ||  ||||||||||||    
18528215 atcttagaaatcgtggttggatctaacacaaccctacaaaatcgatttgtgaggtgaggattg-ccgccacttataaaca 18528293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #153
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 663 - 722
Target Start/End: Original strand, 24513140 - 24513199
Alignment:
663 ttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattg 722  Q
    |||||| || |||||| ||||||||||| ||||||||||||| || |||| |||||||||    
24513140 ttagaaatcatggttgcgcctaacacaatcccacaaaactggcttctgaggtgaggattg 24513199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #154
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 473 - 516
Target Start/End: Original strand, 27634114 - 27634157
Alignment:
473 acaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||| ||||||||||| || ||||||||||||||||||||||    
27634114 acaaaatcggtttgtgaggtgaggattgcccccacttataaaca 27634157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #155
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 461 - 516
Target Start/End: Original strand, 34358051 - 34358106
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||||||||||||||||| || |||  || |||||||||||| |||||||||    
34358051 taacacaaccccacaaaaccggcttctgatgtgaggattgcccccatttataaaca 34358106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #156
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 461 - 516
Target Start/End: Original strand, 35645786 - 35645841
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    ||||||||||| | ||||| || ||||||| || ||||||||||||||||||||||    
35645786 taacacaaccctaaaaaactggcttgtgaggtgaggattgcccccacttataaaca 35645841  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #157
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 579 - 701
Target Start/End: Original strand, 42842159 - 42842282
Alignment:
579 cgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatctt-gaagagactcagatatcatcttagaactcgtggtt 677  Q
    |||||| ||||||||| ||||| | |||||||||||| ||||| || || | |||||||||||| ||| || ||  ||||||||||||||  | ||||||    
42842159 cgtggatataaatggttggtggtcggatagcggaaacatgataacatgtggtccaatggatcttagaaaaggctatgatatcatcttagatattgtggtt 42842258  T
678 gggcctaacacaaccccacaaaac 701  Q
    | | |||| |||| ||||| ||||    
42842259 gagtctaagacaaacccactaaac 42842282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #158
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 662 - 709
Target Start/End: Original strand, 45784870 - 45784917
Alignment:
662 cttagaactcgtggttgggcctaacacaaccccacaaaactggtttgt 709  Q
    ||||||| | ||||||||||||||||||||| |||||||| |||||||    
45784870 cttagaaatggtggttgggcctaacacaacctcacaaaaccggtttgt 45784917  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #159
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 659 - 701
Target Start/End: Complemental strand, 2516286 - 2516244
Alignment:
659 catcttagaactcgtggttgggcctaacacaaccccacaaaac 701  Q
    |||||||||| | |||||||| |||||||||||||||||||||    
2516286 catcttagaaattgtggttggacctaacacaaccccacaaaac 2516244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #160
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 438 - 516
Target Start/End: Complemental strand, 6218525 - 6218447
Alignment:
438 gtcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    ||||||||| |||| ||||  | ||||||||  ||| |||||||| ||||||| ||  |||||||||||||||||||||    
6218525 gtcttagaaatcgtggttgagcctaacacaattccataaaaccggcttgtgaggtgatgattgcccccacttataaaca 6218447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #161
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 661 - 739
Target Start/End: Complemental strand, 6218524 - 6218447
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||| ||||||||| |||||||||||  ||| ||||| || ||||||| ||| ||||| ||| ||||||||||||    
6218524 tcttagaaatcgtggttgagcctaacacaattccataaaaccggcttgtgaggtgatgattg-cccccacttataaaca 6218447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #162
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 586 - 664
Target Start/End: Original strand, 6666743 - 6666821
Alignment:
586 ataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatctt 664  Q
    |||||||||||| |||| |||||||||| |||||||  ||||  |||||||||| ||| ||| |||| |||| ||||||    
6666743 ataaatggtgggcggcctgatagcggaatcctgataaaaggtgtcccaatggattttggagatactctgataccatctt 6666821  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #163
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 473 - 515
Target Start/End: Original strand, 17222685 - 17222727
Alignment:
473 acaaaaccggtttgtgagatgtggattgcccccacttataaac 515  Q
    |||||||||| ||||||| || |||||||||||||||||||||    
17222685 acaaaaccggcttgtgaggtgaggattgcccccacttataaac 17222727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #164
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 661 - 739
Target Start/End: Original strand, 44118858 - 44118935
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    ||||| || ||||||| ||  |||||||||||||||||||| || ||||||| ||||||||  ||| ||||||||||||    
44118858 tcttataaatcgtggtgggctctaacacaaccccacaaaacgggcttgtgaggtgaggatt-acccccacttataaaca 44118935  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #165
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 591 - 696
Target Start/End: Original strand, 50870627 - 50870733
Alignment:
591 tggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatctt-gaagagactcagatatcatcttagaactcgtggttgggcctaacaca 689  Q
    |||||||| ||| ||| || ||||||| |||||||||||| ||| |||| || || |||  || |||| |||||||||| | ||||||| |||||| |||    
50870627 tggtgggtagccggattgcagaaacctaatagcaggtagcgcaacggatattggaggaggttctgataccatcttagaaattgtggttgagcctaataca 50870726  T
690 accccac 696  Q
    |||||||    
50870727 accccac 50870733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #166
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 682 - 739
Target Start/End: Original strand, 6666220 - 6666276
Alignment:
682 ctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    ||||||||||||||||||||  ||||||||| ||||||||| ||| || |||||||||    
6666220 ctaacacaaccccacaaaacctgtttgtgaggtgaggattg-cccccaattataaaca 6666276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #167
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 467 - 516
Target Start/End: Complemental strand, 7892605 - 7892556
Alignment:
467 aaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||||||||||| ||||||||||   |||||| |||||||||||||    
7892605 aaccccacaaaaccggattgtgagatgaaaattgcctccacttataaaca 7892556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #168
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 670 - 739
Target Start/End: Original strand, 12005477 - 12005545
Alignment:
670 tcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||| |||||| ||||||||||| |||||||| || ||||||| ||||||||| ||| ||||||| ||||    
12005477 tcgttgttgggtctaacacaacctcacaaaaccggcttgtgaggtgaggattg-cccccacttattaaca 12005545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #169
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 461 - 514
Target Start/End: Original strand, 21750063 - 21750116
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaa 514  Q
    ||||| |||||||||||||||| ||||||| || ||| ||| ||||||||||||    
21750063 taacataaccccacaaaaccggcttgtgaggtgaggaatgctcccacttataaa 21750116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #170
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 439 - 516
Target Start/End: Original strand, 35819127 - 35819204
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    ||||| || |||| ||||| | |||||||||| |||||||| || |||||||  | ||||||||||||| ||||||||    
35819127 tcttaaaaatcgtggttgggcctaacacaacctcacaaaactggcttgtgaggcgaggattgcccccacatataaaca 35819204  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #171
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 661 - 722
Target Start/End: Original strand, 41187931 - 41187992
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattg 722  Q
    |||||||| |||||||||||| |||| ||||||||||||||    ||||||| |||||||||    
41187931 tcttagaaatcgtggttgggcataactcaaccccacaaaaccaacttgtgaggtgaggattg 41187992  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #172
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 654 - 699
Target Start/End: Original strand, 52827417 - 52827462
Alignment:
654 gatatcatcttagaactcgtggttgggcctaacacaaccccacaaa 699  Q
    |||| |||||||||| || |||||||||||||||||||| ||||||    
52827417 gataccatcttagaaatcatggttgggcctaacacaacctcacaaa 52827462  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #173
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 471 - 516
Target Start/End: Original strand, 54055064 - 54055108
Alignment:
471 ccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    ||||||||| || |||||||||| ||||||||||||||||||||||    
54055064 ccacaaaac-ggcttgtgagatgaggattgcccccacttataaaca 54055108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 141; Significance: 2e-73; HSPs: 162)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 141; E-Value: 2e-73
Query Start/End: Original strand, 437 - 736
Target Start/End: Complemental strand, 26177230 - 26176919
Alignment:
437 agtcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaacatcttata------------- 523  Q
    |||||||||| |||| ||||| | ||||||||||||||||||| ||||| |||| || ||||||||||||||||||||||  || |                  
26177230 agtcttagaaatcgtggttgggcctaacacaaccccacaaaactggtttttgaggtgaggattgcccccacttataaacacgttgtcaggtcatgtcctg 26177131  T
524 ttcgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagc 623  Q
    | ||||||||||| ||||| ||||| | |||| |||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||| ||||||||    
26177130 tccgatgtgggactcttaacacaccccgtcacgaccagcactattggacttggttcgtggatataaatggtgggtggtccgatagcggaaatctgatagc 26177031  T
624 aggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgt 723  Q
    |||| ||||||||||||||| |||| ||| ||||||||||||||| ||| |||||||||||||||||||||||||||| ||||| |||| |||||||||     
26177030 aggtggcccaatggatcttggagaggctctgatatcatcttagaaatcgcggttgggcctaacacaaccccacaaaaccggtttttgaggtgaggattg- 26176932  T
724 ccctcacttataa 736  Q
    |||||||||||||    
26176931 ccctcacttataa 26176919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 129; E-Value: 2e-66
Query Start/End: Original strand, 439 - 722
Target Start/End: Complemental strand, 35772349 - 35772053
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca-------------tcttatatt 525  Q
    |||||||| |||| ||||| | |||||||||||||||||||||| || |||| |  ||||||||||||||||||||||             |||  |||     
35772349 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttctgaggtaaggattgcccccacttataaacacattgtcaggccatctcctatc 35772250  T
526 cgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcag 625  Q
    ||||||||||| ||||| |||||  ||||||||| |||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
35772249 cgatgtgggactcttaacacacccgctcacaaccggcactattgggcttggttcgtggacataaatggtgggtggcccgatagcggaaacctgatagcag 35772150  T
626 gtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattg 722  Q
     | ||||||||||||||||  || ||| |||| |||||||||| |||||||||||||||||||||||||||||||| || ||| ||| |||||||||    
35772149 atggcccaatggatcttgagaaggctctgataccatcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgcgaggtgaggattg 35772053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 118; E-Value: 9e-60
Query Start/End: Original strand, 526 - 739
Target Start/End: Original strand, 4112870 - 4113082
Alignment:
526 cgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcag 625  Q
    ||||||||||| ||||| ||||| |||||| |||||||||||||  ||||||||||||| ||||||||||||||| || ||||||||||||||||||  |    
4112870 cgatgtgggactcttaacacaccccctcacgaccagcactattgagcttggttcgtggacataaatggtgggtggtccaatagcggaaacctgatagatg 4112969  T
626 gtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtcc 725  Q
    || || |||||||||||| |||| ||| |||| |||||||||| |||||||||||||||||||||||||||||||| || ||||||| ||||||||| ||    
4112970 gtggctcaatggatcttggagaggctccgataccatcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattg-cc 4113068  T
726 ctcacttataaaca 739  Q
    | ||||||||||||    
4113069 cccacttataaaca 4113082  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 105; E-Value: 5e-52
Query Start/End: Original strand, 552 - 739
Target Start/End: Original strand, 39348242 - 39348428
Alignment:
552 tcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatctt-gaagagac 650  Q
    |||| |||||||||||||| ||||||||||||| ||||||||||||||| ||||||| |||||||||||||||||| |||||||||| ||| || ||| |    
39348242 tcacgaccagcactattgggcttggttcgtggacataaatggtgggtggtccgatagtggaaacctgatagcaggtggcccaatggaccttggaggaggc 39348341  T
651 tcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    || |||| |||||||||| |||| ||||||||||||||||||||||||||| |||||||||| ||||||||| ||| ||||||||||||    
39348342 tctgataccatcttagaaatcgt-gttgggcctaacacaaccccacaaaaccggtttgtgaggtgaggattg-cccccacttataaaca 39348428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 100; E-Value: 5e-49
Query Start/End: Original strand, 526 - 721
Target Start/End: Original strand, 2859491 - 2859686
Alignment:
526 cgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcag 625  Q
    ||||||||||| ||||  || || |||||| |||||||||||||| ||||||||||||| |||||||||||||||||||||||| ||||||| |||| ||    
2859491 cgatgtgggactcttatcaccccccctcacgaccagcactattgggcttggttcgtggacataaatggtgggtggcccgatagcagaaacctaatagaag 2859590  T
626 gtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggatt 721  Q
    || |||||||||||||||||||| |||  ||| |||||||||| |  |||||||| ||||||||||| |||||||| || ||||||| ||||||||    
2859591 gtggcccaatggatcttgaagaggctctaataccatcttagaaatgatggttggggctaacacaacctcacaaaaccggcttgtgaggtgaggatt 2859686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 99; E-Value: 2e-48
Query Start/End: Original strand, 574 - 740
Target Start/End: Complemental strand, 30370007 - 30369842
Alignment:
574 tggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgt 673  Q
    ||||||||||| ||||||||||||||||||||||| ||||||||||||||||||  |||||||||||||| |||| ||| ||||  ||||||||| ||||    
30370007 tggttcgtggacataaatggtgggtggcccgatagtggaaacctgatagcaggtgacccaatggatcttggagaggctctgatacaatcttagaaatcgt 30369908  T
674 ggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaacat 740  Q
    |||||||||||||||||||||||||||||   ||||||| ||||||||| |||| ||||||||||||    
30369907 ggttgggcctaacacaaccccacaaaactatcttgtgaggtgaggattgcccct-acttataaacat 30369842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 98; E-Value: 8e-48
Query Start/End: Original strand, 439 - 739
Target Start/End: Complemental strand, 38733467 - 38733160
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaacatctt-------------atatt 525  Q
    |||||||| |||| ||||| | |||||||||| |||||||||||  | |||| || ||||||||| ||||||||||||| ||             ||||     
38733467 tcttagaaatcgttgttgggcctaacacaacctcacaaaaccggcctatgaggtgaggattgccctcacttataaacatattgtcagaccatcacatatc 38733368  T
526 cgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcag 625  Q
    ||||||||||| ||||| ||||| | |||| |||||||||||||| ||| |||||| || |||||||||||||||    |||||||||||||||||||||    
38733367 cgatgtgggactcttaacacacctcttcacgaccagcactattgggcttagttcgtagatataaatggtgggtgg----atagcggaaacctgatagcag 38733272  T
626 gtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtcc 725  Q
    || | ||||||||||||| |||||||| |||| |||||||||| |||||||||  |||||||||| | |||||||| |  |||||||||||| |||||||    
38733271 gtggtccaatggatcttggagagactctgataccatcttagaaatcgtggttgaacctaacacaatctcacaaaaccgacttgtgagatgagaattgtcc 38733172  T
726 ctcacttataaaca 739  Q
      ||||||||||||    
38733171 --cacttataaaca 38733160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 97; E-Value: 3e-47
Query Start/End: Original strand, 526 - 722
Target Start/End: Original strand, 25145584 - 25145780
Alignment:
526 cgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcag 625  Q
    ||||||| ||| ||||| ||||| |||||| |||||||||||||  |||| |||||||| || |||||||||||| |||||| |||||||||||||||||    
25145584 cgatgtgagactcttaacacaccccctcacgaccagcactattgagcttgattcgtggacattaatggtgggtggtccgataacggaaacctgatagcag 25145683  T
626 gtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattg 722  Q
    || |  |||| ||||||| |||| ||| ||||||||||||||| || ||||||||||||||||||||||||||| | || ||||||| |||||||||    
25145684 gtgggtcaatagatcttggagaggctctgatatcatcttagaaatcatggttgggcctaacacaaccccacaaatccggcttgtgaggtgaggattg 25145780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 95; E-Value: 5e-46
Query Start/End: Original strand, 526 - 724
Target Start/End: Complemental strand, 27413567 - 27413369
Alignment:
526 cgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcag 625  Q
    |||||||||||  |||| |||||  ||||| |||| ||||||||| |||| |||||||| ||||||||||||||||||||||||||||| |||||| |||    
27413567 cgatgtgggacttttaacacaccctctcacgaccaacactattgggcttgattcgtggacataaatggtgggtggcccgatagcggaaatctgataacag 27413468  T
626 gtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtc 724  Q
    || | | ||| ||||||| |||| ||| ||||||||||||||| |||||||||| |||||||||||| |||||||  || ||||||| |||||||||||    
27413467 gtggtctaatagatcttggagaggctctgatatcatcttagaaatcgtggttggacctaacacaacctcacaaaatcggcttgtgaggtgaggattgtc 27413369  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 95; E-Value: 5e-46
Query Start/End: Original strand, 562 - 731
Target Start/End: Complemental strand, 33156918 - 33156748
Alignment:
562 cactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaag-agactcagatatca 660  Q
    ||||||||| |||| |||||||| ||||||||||| ||||||||||||||||||||||||||||||   |||| |||||||| || || |||  ||| ||    
33156918 cactattgggcttgattcgtggacataaatggtggatggcccgatagcggaaacctgatagcaggtgaaccaacggatcttggagtaggctctaatacca 33156819  T
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcact 731  Q
    |||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||| ||| ||||    
33156818 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggtttgtgagatgaggattgccccccact 33156748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 95; E-Value: 5e-46
Query Start/End: Original strand, 521 - 739
Target Start/End: Complemental strand, 38668350 - 38668133
Alignment:
521 atattcgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgat 620  Q
    |||| ||||||||||| ||||| |||||  ||||| ||||||| |||||| |||||||| |||| ||||||| | |||| ||||||||| ||||||||||    
38668350 atatccgatgtgggactcttaacacacccactcacgaccagcaatattgggcttggttcatggacataaatgataggtgacccgatagcagaaacctgat 38668251  T
621 agcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggat 720  Q
    | |||||  ||||||||||| || |||| ||| |||| |||||||||| | ||| ||||||||||||||||||||||||| ||| ||||||||||| |||    
38668250 aacaggtgacccaatggatcatggagaggctctgataccatcttagaaattgtgattgggcctaacacaaccccacaaaattggcttgtgagatgatgat 38668151  T
721 tgtccctcacttataaaca 739  Q
    || ||| ||||||||||||    
38668150 tg-cccccacttataaaca 38668133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 94; E-Value: 2e-45
Query Start/End: Original strand, 526 - 739
Target Start/End: Complemental strand, 16163152 - 16162941
Alignment:
526 cgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcag 625  Q
    ||||||||||| ||||| ||||  |||||| ||||||||||| || ||||| ||||||| ||||||||| ||||||||||||||||||||||||||||||    
16163152 cgatgtgggactcttaacacacaccctcacgaccagcactatggg-cttggctcgtggacataaatggtaggtggcccgatagcggaaacctgatagcag 16163054  T
626 gtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtcc 725  Q
    || ||||| ||||||||| |||| ||  |||||||||||| || | ||||||| | |||||||||||||||||||  ||||| |||| ||||| ||||||    
16163053 gtggcccattggatcttggagaggctttgatatcatcttaaaaattgtggttgagtctaacacaaccccacaaaatcggtttatgaggtgaggtttgtcc 16162954  T
726 ctcacttataaaca 739  Q
    | |||||| |||||    
16162953 c-cacttaaaaaca 16162941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 90; E-Value: 5e-43
Query Start/End: Original strand, 550 - 739
Target Start/End: Original strand, 4098291 - 4098478
Alignment:
550 cctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagaga 649  Q
    |||||| |||| || |||||| ||||||||||||| ||||| |||||||||||||||||| |||||||||| |||||| ||||||||||||||||||||     
4098291 cctcacgaccaacattattgggcttggttcgtggacataaagggtgggtggcccgatagcagaaacctgattgcaggtggcccaatggatcttgaagagt 4098390  T
650 ctcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    ||| |||| || ||||||| ||||||||||||||||||||| ||||||||||    |||| || ||||||||| ||| ||||||||||||    
4098391 ctctgataccaacttagaaatcgtggttgggcctaacacaa-cccacaaaaccaacttgtaaggtgaggattg-cccccacttataaaca 4098478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 89; E-Value: 2e-42
Query Start/End: Original strand, 573 - 709
Target Start/End: Original strand, 51460353 - 51460489
Alignment:
573 ttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcg 672  Q
    |||||||||||| | ||||||||||| |||||||||||||||||||||||||||| ||||||||||||||| |||| ||| |||||||| |||||| |      
51460353 ttggttcgtggacacaaatggtgggtcgcccgatagcggaaacctgatagcaggtggcccaatggatcttggagaggctctgatatcattttagaaatta 51460452  T
673 tggttgggcctaacacaaccccacaaaactggtttgt 709  Q
    |||||||||||||||||||||||||||||||| ||||    
51460453 tggttgggcctaacacaaccccacaaaactggcttgt 51460489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 88; E-Value: 7e-42
Query Start/End: Original strand, 461 - 699
Target Start/End: Complemental strand, 35892354 - 35892103
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaa-------------catcttatattcgatgtgggacgcttaatacac 547  Q
    ||||| |||||||||||||||| ||||||| || | ||||||||||||||||||             ||||||||||  |||||||||| ||||| ||||    
35892354 taacagaaccccacaaaaccgggttgtgaggtgagtattgcccccacttataaatacattgtcagaccatcttatatctgatgtgggactcttaacacac 35892255  T
548 cacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaaga 647  Q
    |  ||||| |||||||| ||||| |||  |||||||| |||||||||||||| ||||||||| ||||  |||||||| || |||||||| ||||||||||    
35892254 cctctcacgaccagcacaattgggcttaattcgtggacataaatggtgggtgccccgatagcagaaatatgatagcaagtggcccaatgaatcttgaaga 35892155  T
648 gactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaa 699  Q
    ||||| |||| | |||||||| |||||| ||||| |||||||||||||||||    
35892154 gactctgataccttcttagaaatcgtggatgggcttaacacaaccccacaaa 35892103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 86; E-Value: 1e-40
Query Start/End: Original strand, 526 - 739
Target Start/End: Complemental strand, 7307941 - 7307729
Alignment:
526 cgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcag 625  Q
    ||||||| ||| ||||||||||| |||||| |||| |||||||||| |||||||||||| ||||||||||||||| || |||||||||||||||||||||    
7307941 cgatgtgagactcttaatacaccccctcacgaccaacactattggatttggttcgtggacataaatggtgggtggtccaatagcggaaacctgatagcag 7307842  T
626 gtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtcc 725  Q
        ||||||||||||||||| ||||  ||||||||||||||| |  ||||| ||||||||| || || ||||||| |  ||||||| |||| |||| ||    
7307841 acgacccaatggatcttgaagtgactatgatatcatcttagaaattatggttaggcctaacataatccaacaaaaccgacttgtgaggtgagaattg-cc 7307743  T
726 ctcacttataaaca 739  Q
      ||||||||||||    
7307742 tccacttataaaca 7307729  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 79; E-Value: 2e-36
Query Start/End: Original strand, 526 - 648
Target Start/End: Complemental strand, 25713378 - 25713256
Alignment:
526 cgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcag 625  Q
    ||||||||||| ||||| || || |||||| |||| ||||||||| ||||||||||||| |||||||||||||||||||||||||||||| |||||||||    
25713378 cgatgtgggactcttaacaccccccctcacgaccaacactattgggcttggttcgtggacataaatggtgggtggcccgatagcggaaacttgatagcag 25713279  T
626 gtagcccaatggatcttgaagag 648  Q
    || ||||||||||||||| ||||    
25713278 gtggcccaatggatcttggagag 25713256  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 78; E-Value: 7e-36
Query Start/End: Original strand, 453 - 657
Target Start/End: Complemental strand, 52961653 - 52961436
Alignment:
453 gttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca-------------tcttatattcgatgtgggacgct 539  Q
    ||||||| ||||||||||||| |||||||| || |||| || ||||||||| ||||||||||||             |||  ||| ||||||||||| ||    
52961653 gttggacctaacacaaccccataaaaccggcttttgaggtgaggattgccctcacttataaacacattgtcagaccatctcctatccgatgtgggacact 52961554  T
540 taatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggat 639  Q
    ||| ||||| |||||| || ||||||||||  |||| |||||| | |||| ||||||||||||||||||||||||||||||||||||| |||||||||||    
52961553 taacacaccccctcacgactagcactattgagcttgtttcgtgtacataactggtgggtggcccgatagcggaaacctgatagcaggtggcccaatggat 52961454  T
640 cttgaagagactcagata 657  Q
    ||||||||| ||| ||||    
52961453 cttgaagaggctctgata 52961436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 75; E-Value: 4e-34
Query Start/End: Original strand, 526 - 668
Target Start/End: Original strand, 4112639 - 4112781
Alignment:
526 cgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcag 625  Q
    ||||||||||| ||||| || || |||||| |||| ||||||||| |||||||||| || |||||||||||||||  |||||||||||||||||||||||    
4112639 cgatgtgggactcttaacaccccccctcacgaccaacactattgggcttggttcgttgacataaatggtgggtggttcgatagcggaaacctgatagcag 4112738  T
626 gtagcccaatggatcttgaagagactcagatatcatcttagaa 668  Q
    || | ||||||||||||| |||| ||| |||| ||||||||||    
4112739 gtggtccaatggatcttggagaggctctgataccatcttagaa 4112781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 74; E-Value: 2e-33
Query Start/End: Original strand, 586 - 739
Target Start/End: Complemental strand, 51589152 - 51589000
Alignment:
586 ataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaa 685  Q
    |||||||  ||||||||||||| ||||||||||||| ||||| |||||| | ||| ||||||| ||  |||| ||| |||||| | ||||||||||||||    
51589152 ataaatgacgggtggcccgataacggaaacctgataacaggtggcccaaagaatcgtgaagaggctttgataccatattagaaatggtggttgggcctaa 51589053  T
686 cacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||||||||||| || ||||||| ||||||||| ||||||||||||||||    
51589052 cacaaccccacaaaaccggcttgtgaggtgaggattg-ccctcacttataaaca 51589000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 72; E-Value: 3e-32
Query Start/End: Original strand, 550 - 701
Target Start/End: Original strand, 26173344 - 26173495
Alignment:
550 cctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagaga 649  Q
    |||||| |||||||| ||||  ||| ||||||||| |||||||||||| || |||||||||||||||||||||||||| | || |||||| | ||||||     
26173344 cctcacgaccagcacaattgagcttagttcgtggacataaatggtggggggtccgatagcggaaacctgatagcaggtggtccgatggatatcgaagagg 26173443  T
650 ctcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaac 701  Q
    ||| |||||||| ||||||   |||||||| |||||||||||||||||||||    
26173444 ctctgatatcattttagaaagggtggttggacctaacacaaccccacaaaac 26173495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 70; E-Value: 4e-31
Query Start/End: Original strand, 586 - 739
Target Start/End: Complemental strand, 51589966 - 51589814
Alignment:
586 ataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaa 685  Q
    |||||||  ||||||||||||| ||||||||| |||  |||| |||||| | ||| ||||||| ||| |||| ||| |||||| ||||||||||||||||    
51589966 ataaatgacgggtggcccgataacggaaacctaataataggtggcccaaagaatcgtgaagaggctctgataccatattagaaatcgtggttgggcctaa 51589867  T
686 cacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||||||||||  || ||||||| ||||||||| ||||||||||||||||    
51589866 cacaaccccacaaaatcggcttgtgaggtgaggattg-ccctcacttataaaca 51589814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 66; E-Value: 1e-28
Query Start/End: Original strand, 586 - 739
Target Start/End: Complemental strand, 3169926 - 3169774
Alignment:
586 ataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaa 685  Q
    |||||||  ||||||||||||| ||||||||||||| ||||| ||| || | ||| |||||  |||| |||| ||| |||||| ||||||||||||||||    
3169926 ataaatgacgggtggcccgataacggaaacctgataacaggtggcctaaagaatcgtgaaggaactctgataccatattagaaatcgtggttgggcctaa 3169827  T
686 cacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||||||||||| || ||||||| ||| ||||| ||| ||||||||||||    
3169826 cacaaccccacaaaaccggcttgtgaggtgaagattg-cccccacttataaaca 3169774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 538 - 701
Target Start/End: Original strand, 31496247 - 31496410
Alignment:
538 cttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatgg 637  Q
    ||||| ||||| | |||| |||||||||| ||  |||| || ||| | ||||||||||||||| |||||||||| ||||||||||||||| | |||||||    
31496247 cttaacacaccccttcacgaccagcactactgagcttgattagtgcacataaatggtgggtggtccgatagcgggaacctgatagcaggtggtccaatgg 31496346  T
638 atcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaac 701  Q
    ||||| |||||||||  |||  ||||||||| ||||| ||| | |||||||||||||| |||||    
31496347 atcttaaagagactctaatactatcttagaaatcgtgattgagtctaacacaaccccataaaac 31496410  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #25
Raw Score: 61; E-Value: 9e-26
Query Start/End: Original strand, 516 - 740
Target Start/End: Complemental strand, 9499475 - 9499253
Alignment:
516 atcttatattcgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaac 615  Q
    |||| ||| |||||||| ||| ||||| ||||| | ||||||||| ||| || ||   ||||||||||| | ||||||||||||| || ||| | |||||    
9499475 atctcatagtcgatgtgagactcttaacacaccccttcacaaccaacaccatcgggtatggttcgtggacaaaaatggtgggtggtccaataacagaaac 9499376  T
616 ctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatg 715  Q
    ||  || || || | ||||||||  |||||||||||| |||||||| |||||| ||||||||| | | |||||||||||||||||| || ||||||| ||    
9499375 ctactaacaagtggtccaatggactttgaagagactctgatatcattttagaaatcgtggttgagtcgaacacaaccccacaaaaccgg-ttgtgaggtg 9499277  T
716 aggattgtccctcacttataaacat 740  Q
    | ||||| |||| ||||||||||||    
9499276 aagattgcccct-acttataaacat 9499253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #26
Raw Score: 60; E-Value: 4e-25
Query Start/End: Original strand, 526 - 700
Target Start/End: Original strand, 8870788 - 8870948
Alignment:
526 cgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcag 625  Q
    ||||||||||| ||||| ||||| |||||| |||||||| |||||  |||||||||||| ||||||||||||||||               |||||||||    
8870788 cgatgtgggactcttaacacaccccctcacgaccagcacaattgggtttggttcgtggacataaatggtgggtggct--------------tgatagcag 8870873  T
626 gtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaa 700  Q
    || ||||||||||| ||| |||||||| |||| |||||||||| | |||||||| ||||||||||||||||||||    
8870874 gtggcccaatggatattggagagactctgataccatcttagaaatggtggttggacctaacacaaccccacaaaa 8870948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #27
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 522 - 722
Target Start/End: Complemental strand, 7653465 - 7653265
Alignment:
522 tattcgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgata 621  Q
    ||||||||||||||||||||| ||||  |||||| |||| ||||||||   |||||||||| | ||||||||||| || |||||||| ||||||  ||||    
7653465 tattcgatgtgggacgcttaacacactccctcacgaccaacactattgcgtttggttcgtgtacataaatggtggatgccccgatagtggaaactggata 7653366  T
622 gcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggatt 721  Q
    | | || ||| | |||||||||||||  | | |||||||||||| || | ||| ||| |||||||||||  |||||| ||  | ||||||| ||||||||    
7653365 gtaagtggcctattggatcttgaagaagcactgatatcatcttaaaaattgtgattgagcctaacacaaatccacaagaccagcttgtgaggtgaggatt 7653266  T
722 g 722  Q
    |    
7653265 g 7653265  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #28
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 550 - 721
Target Start/End: Original strand, 12376561 - 12376732
Alignment:
550 cctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttga-agag 648  Q
    |||||| |||| ||||||||| ||||||||||||| ||||||||| ||||||| |||||| | ||||||||||||||| |||||||||||||| |  ||     
12376561 cctcacgaccaacactattgggcttggttcgtggacataaatggtaggtggcctgatagcag-aacctgatagcaggtggcccaatggatcttaacggat 12376659  T
649 actcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggatt 721  Q
     |||  ||| || ||||||| |||| ||||| |||||| |||||||| ||||  || ||||||| ||||||||    
12376660 gctctaataccaacttagaaatcgtcgttggacctaactcaaccccataaaaacggcttgtgaggtgaggatt 12376732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #29
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 604 - 739
Target Start/End: Original strand, 32783223 - 32783357
Alignment:
604 gatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactg 703  Q
    |||||| ||||||||||||||||| |  ||||||||||||||||||||| |||| |||||||||| ||||||||||  |||||| ||  ||| ||||||     
32783223 gatagcagaaacctgatagcaggtggtacaatggatcttgaagagactctgataccatcttagaaatcgtggttggatctaacaaaattccataaaacta 32783322  T
704 gtttgtgagatgaggattgtccctcacttataaaca 739  Q
    | ||||||||||| ||||| ||| | ||||||||||    
32783323 gcttgtgagatgaagattg-cccccgcttataaaca 32783357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #30
Raw Score: 55; E-Value: 4e-22
Query Start/End: Original strand, 544 - 646
Target Start/End: Complemental strand, 17208756 - 17208654
Alignment:
544 acaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttg 643  Q
    ||||| ||||||  ||| ||||||||| ||||||  ||||| |||||||||||||||||||||||||||||||||||||||| | || ||| ||||||||    
17208756 acaccccctcacgcccaacactattgggcttggtgggtggatataaatggtgggtggcccgatagcggaaacctgatagcagatggctcaagggatcttg 17208657  T
644 aag 646  Q
    |||    
17208656 aag 17208654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #31
Raw Score: 55; E-Value: 4e-22
Query Start/End: Original strand, 661 - 739
Target Start/End: Complemental strand, 26177228 - 26177151
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||| |||||||||||||||||||||||||||||||||||||| |||| ||||||||| ||| ||||||||||||    
26177228 tcttagaaatcgtggttgggcctaacacaaccccacaaaactggtttttgaggtgaggattg-cccccacttataaaca 26177151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #32
Raw Score: 55; E-Value: 4e-22
Query Start/End: Original strand, 439 - 517
Target Start/End: Original strand, 41035826 - 41035904
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaacat 517  Q
    |||||||| |||||||||||| |||||||| ||||||||||||| ||||||| || |||||||||||||||||||||||    
41035826 tcttagaaatcgtagttggacctaacacaatcccacaaaaccggcttgtgaggtgaggattgcccccacttataaacat 41035904  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #33
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 550 - 642
Target Start/End: Complemental strand, 369828 - 369735
Alignment:
550 cctcacaaccagcactattggacttggttcgtggaaataaatggtgggtg-gcccgatagcggaaacctgatagcaggtagcccaatggatctt 642  Q
    |||||| |||||||||||||| ||||||||||||| ||||||||||||||  ||||||||||||||||||||||||| |   ||||||||||||    
369828 cctcacgaccagcactattgggcttggttcgtggacataaatggtgggtgaccccgatagcggaaacctgatagcagctgatccaatggatctt 369735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #34
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 572 - 739
Target Start/End: Original strand, 9146773 - 9146940
Alignment:
572 cttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaag-agactcagatatcatcttagaact 670  Q
    ||||||||||||| |||||||||||||| ||||||||||| ||||| || |||| | | ||||||||||||| || || ||| |||| |||||||||| |    
9146773 cttggttcgtggacataaatggtgggtgacccgatagcggtaaccttattgcagttggtccaatggatcttggagaaggctctgataccatcttagaaat 9146872  T
671 cgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
      |||||| || || |||||| ||||||||| || |||||||  |||||||| ||| | ||||||||||    
9146873 tatggttgagcgtagcacaactccacaaaaccggcttgtgaggagaggattgaccc-cgcttataaaca 9146940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #35
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 612 - 739
Target Start/End: Original strand, 26346919 - 26347044
Alignment:
612 aaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtga 711  Q
    |||||| ||||||||| | |||| |||| |||| ||| ||| ||||||||||||||| |||||||  ||| ||||||||||||||||||| || ||||||    
26346919 aaacctaatagcaggtggtccaacggattttgaggaggctctgatatcatcttagaaatcgtggtgaggc-taacacaaccccacaaaacgggcttgtga 26347017  T
712 gatgaggattgtccctcacttataaaca 739  Q
    | ||||||||||| | ||||||||||||    
26347018 ggtgaggattgtctc-cacttataaaca 26347044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #36
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 538 - 624
Target Start/End: Original strand, 34264597 - 34264683
Alignment:
538 cttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagca 624  Q
    ||||| ||||| |||||| |||||||||||||  |||||||||| || ||||||||||| || ||||||||||||||||||||||||    
34264597 cttaacacaccccctcacgaccagcactattgtgcttggttcgtcgatataaatggtggttgacccgatagcggaaacctgatagca 34264683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #37
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 438 - 516
Target Start/End: Complemental strand, 40079238 - 40079160
Alignment:
438 gtcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    ||||||||| |||| ||||| | |||||||||||||||||||||| ||||||| || ||||||||||||||||||||||    
40079238 gtcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaaca 40079160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #38
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 661 - 739
Target Start/End: Complemental strand, 40079237 - 40079160
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||| |||||||||||||||||||||||||||||||| || ||||||| ||||||||| ||| ||||||||||||    
40079237 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattg-cccccacttataaaca 40079160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #39
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 439 - 516
Target Start/End: Original strand, 4113005 - 4113082
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| |||| ||||| | |||||||||||||||||||||| ||||||| || ||||||||||||||||||||||    
4113005 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaaca 4113082  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #40
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 439 - 516
Target Start/End: Original strand, 39348352 - 39348428
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| |||| ||||| | |||||||||||||||||||||||||||||| || ||||||||||||||||||||||    
39348352 tcttagaaatcgt-gttgggcctaacacaaccccacaaaaccggtttgtgaggtgaggattgcccccacttataaaca 39348428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #41
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 654 - 739
Target Start/End: Complemental strand, 51589318 - 51589234
Alignment:
654 gatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||| ||| |||||| |||||||| ||||||||||||||||||||||| || ||||||| ||||||||| ||||||||||||||||    
51589318 gataccatattagaaatcgtggttaggcctaacacaaccccacaaaaccggcttgtgaggtgaggattg-ccctcacttataaaca 51589234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #42
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 453 - 516
Target Start/End: Original strand, 12244975 - 12245038
Alignment:
453 gttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    ||||||| |||||||||||||||||||||| ||||||| || ||||||||||||||||||||||    
12244975 gttggacctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaaca 12245038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #43
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 663 - 737
Target Start/End: Original strand, 17452680 - 17452753
Alignment:
663 ttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaa 737  Q
    |||||| |||||||||||||||||||||||||||||||| || ||||||| ||||||||| ||| ||||||||||    
17452680 ttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattg-cccccacttataaa 17452753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #44
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 439 - 505
Target Start/End: Complemental strand, 33156818 - 33156752
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgccccc 505  Q
    |||||||| |||| ||||| | ||||||||||||||||||||||||||||||||| |||||||||||    
33156818 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggtttgtgagatgaggattgccccc 33156752  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #45
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 441 - 514
Target Start/End: Original strand, 17452680 - 17452753
Alignment:
441 ttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaa 514  Q
    |||||| |||| ||||| | |||||||||||||||||||||| ||||||| || ||||||||||||||||||||    
17452680 ttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaa 17452753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #46
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 624 - 737
Target Start/End: Original strand, 17452790 - 17452902
Alignment:
624 aggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgt 723  Q
    |||| ||||||||||| ||  |||| |||  ||| |||||||||| |||||||| ||||||||||||||||||||||| || ||||||| ||| |||||     
17452790 aggtggcccaatggattttagagaggctctaataccatcttagaaatcgtggttaggcctaacacaaccccacaaaaccggcttgtgaggtgaagattg- 17452888  T
724 ccctcacttataaa 737  Q
    ||| ||||||||||    
17452889 cccccacttataaa 17452902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #47
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 659 - 724
Target Start/End: Complemental strand, 25255398 - 25255333
Alignment:
659 catcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtc 724  Q
    |||||||||| |||||||||||||||||||||||||||||||| || ||||||| |||| ||||||    
25255398 catcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgagaattgtc 25255333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #48
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 658 - 735
Target Start/End: Original strand, 31432226 - 31432303
Alignment:
658 tcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttata 735  Q
    ||||||||||| ||||||||||||||| |||||||||||||||| || ||||||| ||||||||| ||| || |||||    
31432226 tcatcttagaaatcgtggttgggcctagcacaaccccacaaaaccggcttgtgaggtgaggattgccccccatttata 31432303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #49
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 661 - 722
Target Start/End: Original strand, 42586438 - 42586499
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattg 722  Q
    |||||||| ||||||||||||||||||||||||||||||| ||| ||||||| |||||||||    
42586438 tcttagaaatcgtggttgggcctaacacaaccccacaaaattggcttgtgaggtgaggattg 42586499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #50
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 615 - 695
Target Start/End: Original strand, 51460003 - 51460083
Alignment:
615 cctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaacccca 695  Q
    ||||||||||||| ||||||||||||||| |||| | |  ||| |||||||||| | ||||||||||||||||||||||||    
51460003 cctgatagcaggtggcccaatggatcttggagaggcgctaataccatcttagaaattgtggttgggcctaacacaacccca 51460083  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #51
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 441 - 516
Target Start/End: Complemental strand, 3169849 - 3169774
Alignment:
441 ttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||| |||| ||||| | |||||||||||||||||||||| ||||||| ||  |||||||||||||||||||||    
3169849 ttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaagattgcccccacttataaaca 3169774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #52
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 660 - 739
Target Start/End: Complemental strand, 35772350 - 35772272
Alignment:
660 atcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    ||||||||| |||||||||||||||||||||||||||||||| || || |||| | ||||||| ||| ||||||||||||    
35772350 atcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttctgaggtaaggattg-cccccacttataaaca 35772272  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #53
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 586 - 700
Target Start/End: Complemental strand, 5109410 - 5109296
Alignment:
586 ataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaa 685  Q
    |||||||||||||| |||||||  ||||||||||||| |||| || ||| | |||||| |||||||| |||| ||||||| || | ||  |||| |||||    
5109410 ataaatggtgggtgacccgataatggaaacctgatagaaggtggctcaacgaatcttggagagactctgataccatcttaaaaattgtaattggacctaa 5109311  T
686 cacaaccccacaaaa 700  Q
    ||||| |||||||||    
5109310 cacaatcccacaaaa 5109296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #54
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 550 - 632
Target Start/End: Original strand, 12325420 - 12325501
Alignment:
550 cctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagccc 632  Q
    |||||| |||| ||||||||| ||||||||||||| ||||||||| |||||||||||| | | ||||||||||||||| ||||    
12325420 cctcacgaccaacactattgggcttggttcgtggacataaatggtaggtggcccgataacag-aacctgatagcaggtggccc 12325501  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #55
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 672 - 722
Target Start/End: Complemental strand, 38080678 - 38080628
Alignment:
672 gtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattg 722  Q
    ||||||||||||||||||||||||||||||||| ||||||| |||||||||    
38080678 gtggttgggcctaacacaaccccacaaaactggcttgtgaggtgaggattg 38080628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #56
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 439 - 516
Target Start/End: Original strand, 15986332 - 15986409
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| | || ||||||| |||||||||||||||| ||| | ||||||| || ||||||||||||||||||||||    
15986332 tcttagaaatggtggttggacctaacacaaccccacaataccagcttgtgaggtgaggattgcccccacttataaaca 15986409  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #57
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 606 - 738
Target Start/End: Original strand, 50695777 - 50695909
Alignment:
606 tagcggaaacctgatagcaggtagcccaatggatcttgaag-agactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactgg 704  Q
    |||| ||||||||||| ||||| |||||| ||| ||||||| || ||  | || |||||||||| | ||| || |||||||| |||||||||||||| ||    
50695777 tagcagaaacctgataacaggtggcccaagggagcttgaaggaggctttggtaccatcttagaatttgtgcttaggcctaactcaaccccacaaaaccgg 50695876  T
705 tttgtgagatgaggattgtccctcacttataaac 738  Q
     ||||||| ||||||||  |||||||||||||||    
50695877 cttgtgagctgaggatt-accctcacttataaac 50695909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #58
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 562 - 701
Target Start/End: Original strand, 52676409 - 52676547
Alignment:
562 cactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaa-gagactcagatatca 660  Q
    |||||||||  ||||| |||||| ||||||| ||||||||| ||| ||||||| ||||||| |||| ||||  |||||||||||  || ||| |  | ||    
52676409 cactattgggtttggtgcgtggatataaatgatgggtggcctgattgcggaaatctgatagtaggtggcccggtggatcttgaaccaggctctg--acca 52676506  T
661 tcttagaactcgtggttgggcctaacacaaccccacaaaac 701  Q
    |||||||| | |||||||| | |||||||||||||||||||    
52676507 tcttagaatttgtggttggacataacacaaccccacaaaac 52676547  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #59
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 562 - 626
Target Start/End: Complemental strand, 11524946 - 11524882
Alignment:
562 cactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcagg 626  Q
    ||||||| |||||||| |||||| |||||| |||||||||| ||||||| |||||||||||||||    
11524946 cactattagacttggtgcgtggatataaatagtgggtggccagatagcgaaaacctgatagcagg 11524882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #60
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 562 - 626
Target Start/End: Complemental strand, 11525161 - 11525097
Alignment:
562 cactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcagg 626  Q
    ||||||| |||||||| |||||| |||||| |||||||||| ||||||| |||||||||||||||    
11525161 cactattagacttggtgcgtggatataaatagtgggtggccagatagcgaaaacctgatagcagg 11525097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #61
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 586 - 736
Target Start/End: Original strand, 5953660 - 5953810
Alignment:
586 ataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatctt-gaagagactcagatatcatcttagaactcgtggttgggccta 684  Q
    ||||||| ||||||||||||||  |||||||||| ||||||| ||| || ||||||| || ||| ||| |||| ||||||| || | | |||||||||||    
5953660 ataaatgttgggtggcccgataatggaaacctgaaagcaggtggcctaacggatcttggatgaggctctgataccatcttaaaaattgaggttgggccta 5953759  T
685 acacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataa 736  Q
    | |||||| ||| ||||  | |||| || ||| |||||| ||||||||||||    
5953760 atacaacctcactaaaccagcttgttaggtgaagattgt-cctcacttataa 5953810  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #62
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 439 - 514
Target Start/End: Original strand, 17452827 - 17452902
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaa 514  Q
    |||||||| |||| ||| | | |||||||||||||||||||||| ||||||| ||  |||||||||||||||||||    
17452827 tcttagaaatcgtggttaggcctaacacaaccccacaaaaccggcttgtgaggtgaagattgcccccacttataaa 17452902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #63
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 660 - 739
Target Start/End: Complemental strand, 25713479 - 25713401
Alignment:
660 atcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    ||||||||| | |||||| ||||||||||||| |||||||||||| ||||||| ||| ||||| ||| ||||||||||||    
25713479 atcttagaaatggtggttaggcctaacacaactccacaaaactggcttgtgaggtgacgattg-cccccacttataaaca 25713401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #64
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 654 - 701
Target Start/End: Complemental strand, 29266045 - 29265998
Alignment:
654 gatatcatcttagaactcgtggttgggcctaacacaaccccacaaaac 701  Q
    |||| |||||||||| ||||||||||||||||||||||||||||||||    
29266045 gataccatcttagaaatcgtggttgggcctaacacaaccccacaaaac 29265998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #65
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 661 - 720
Target Start/End: Complemental strand, 32223848 - 32223789
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggat 720  Q
    |||||||| | |||||||||||| ||||||||||||| |||||| |||||||||||||||    
32223848 tcttagaaattgtggttgggccttacacaaccccacacaactggcttgtgagatgaggat 32223789  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #66
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 661 - 740
Target Start/End: Complemental strand, 38733467 - 38733389
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaacat 740  Q
    |||||||| |||| |||||||||||||||||| |||||||| ||  | |||| ||||||||| |||||||||||||||||    
38733467 tcttagaaatcgttgttgggcctaacacaacctcacaaaaccggcctatgaggtgaggattg-ccctcacttataaacat 38733389  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #67
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 461 - 516
Target Start/End: Complemental strand, 51589055 - 51589000
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||||||||||||||||| ||||||| || ||||||||| ||||||||||||    
51589055 taacacaaccccacaaaaccggcttgtgaggtgaggattgccctcacttataaaca 51589000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #68
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 461 - 516
Target Start/End: Complemental strand, 51589289 - 51589234
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||||||||||||||||| ||||||| || ||||||||| ||||||||||||    
51589289 taacacaaccccacaaaaccggcttgtgaggtgaggattgccctcacttataaaca 51589234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #69
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 441 - 516
Target Start/End: Complemental strand, 51589889 - 51589814
Alignment:
441 ttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||| |||| ||||| | |||||||||||||||||| ||| ||||||| || ||||||||| ||||||||||||    
51589889 ttagaaatcgtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgaggattgccctcacttataaaca 51589814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #70
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 461 - 516
Target Start/End: Original strand, 52650792 - 52650847
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||||||||||||||| | ||||||| || ||||||||||||||||||||||    
52650792 taacacaaccccacaaaaccagcttgtgaggtgaggattgcccccacttataaaca 52650847  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #71
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 661 - 739
Target Start/End: Complemental strand, 29898997 - 29898920
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||| ||||||||||||||| ||||||| |||||||| || ||||| | |||| |||| ||||||||||||||||    
29898997 tcttagaaatcgtggttgggcctagcacaacctcacaaaaccggcttgtgtggtgagaattg-ccctcacttataaaca 29898920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #72
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 661 - 739
Target Start/End: Original strand, 31181512 - 31181589
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||| | |||||||||||||||||||||||| |||||  | ||||||| ||||||||| ||| ||||||||||||    
31181512 tcttagaatttgtggttgggcctaacacaaccccataaaaccagcttgtgaggtgaggattg-cccccacttataaaca 31181589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #73
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 551 - 621
Target Start/End: Original strand, 33132366 - 33132436
Alignment:
551 ctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgata 621  Q
    |||||||||| ||||||||||||||||||||| | |||||||  |||||| | |||||| |||||||||||    
33132366 ctcacaaccaacactattggacttggttcgtgaacataaatgaggggtggtctgatagcagaaacctgata 33132436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #74
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 663 - 739
Target Start/End: Complemental strand, 51590121 - 51590048
Alignment:
663 ttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||| ||||| ||||||||||||||| |||||||||| || ||||||| |||||||||   ||||||||||||||    
51590121 ttagaaatcgtgcttgggcctaacacaatcccacaaaaccggcttgtgaggtgaggattg---ctcacttataaaca 51590048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #75
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 673 - 739
Target Start/End: Original strand, 52650782 - 52650847
Alignment:
673 tggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||||||||||||||||||||||||  | ||||||| ||||||||| ||| ||||||||||||    
52650782 tggttgggcctaacacaaccccacaaaaccagcttgtgaggtgaggattg-cccccacttataaaca 52650847  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #76
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 465 - 514
Target Start/End: Original strand, 26865383 - 26865432
Alignment:
465 acaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaa 514  Q
    |||||||||||||||||| ||||||| || ||||||||||||||||||||    
26865383 acaaccccacaaaaccggcttgtgaggtggggattgcccccacttataaa 26865432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #77
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 439 - 516
Target Start/End: Original strand, 31181512 - 31181589
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| | || ||||| | ||||||||||||| |||||| | ||||||| || ||||||||||||||||||||||    
31181512 tcttagaatttgtggttgggcctaacacaaccccataaaaccagcttgtgaggtgaggattgcccccacttataaaca 31181589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #78
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 670 - 739
Target Start/End: Complemental strand, 39808541 - 39808474
Alignment:
670 tcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||||||||||||||| ||||||||||| |||||| | | ||||||||||||| ||||||||||||    
39808541 tcgtggttgggcctaacacagccccacaaaaccggtttg-ggggtgaggattgtccc-cacttataaaca 39808474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #79
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 550 - 643
Target Start/End: Original strand, 40189108 - 40189200
Alignment:
550 cctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttg 643  Q
    ||||||| ||| ||||||||| |||||| |||||| ||||||||||| ||| || ||||||||||| |||||||| || |||||| ||| ||||    
40189108 cctcacatccaacactattgggcttggtgcgtggatataaatggtggatgg-cctatagcggaaacttgatagcatgtggcccaacggagcttg 40189200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #80
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 463 - 516
Target Start/End: Complemental strand, 52907445 - 52907392
Alignment:
463 acacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||||||||||||| | ||||||| || ||||||||||||||||||||||    
52907445 acacaaccccacaaaaccagcttgtgaggtgaggattgcccccacttataaaca 52907392  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #81
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 675 - 739
Target Start/End: Original strand, 12244975 - 12245038
Alignment:
675 gttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    ||||| ||||||||||||||||||||| || ||||||| ||||||||| ||| ||||||||||||    
12244975 gttggacctaacacaaccccacaaaaccggcttgtgaggtgaggattg-cccccacttataaaca 12245038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #82
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 663 - 739
Target Start/End: Original strand, 25137304 - 25137379
Alignment:
663 ttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||| | |||||||||||||||||||||||||||||| || || |||| ||||||||| |||  |||||||||||    
25137304 ttagaaattgtggttgggcctaacacaaccccacaaaaccggcttatgaggtgaggattg-cccatacttataaaca 25137379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #83
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 637 - 737
Target Start/End: Complemental strand, 35892400 - 35892301
Alignment:
637 gatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataa 736  Q
    ||||||| | |||||| |||| |||||||||| |  |||||| |||||||| ||||||||||||| || ||||||| |||| |||| ||| |||||||||    
35892400 gatcttggatagactctgataccatcttagaaattatggttgagcctaacagaaccccacaaaaccgggttgtgaggtgagtattg-cccccacttataa 35892302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #84
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 436 - 516
Target Start/End: Complemental strand, 49143041 - 49142961
Alignment:
436 aagtcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    ||||||||||| | || ||||| | |||||||| |||||||||  || ||||||| || ||||||||||||||||||||||    
49143041 aagtcttagaaatggtggttgggcataacacaatcccacaaaattggcttgtgagctgaggattgcccccacttataaaca 49142961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #85
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 683 - 739
Target Start/End: Original strand, 49316166 - 49316221
Alignment:
683 taacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    ||||||||| ||||||||||| |||||||||||| ||||||||| ||||||||||||    
49316166 taacacaactccacaaaactgatttgtgagatgaagattgtccc-cacttataaaca 49316221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #86
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 433 - 516
Target Start/End: Original strand, 4098156 - 4098239
Alignment:
433 tctaagtcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    ||||| |||||||| | || ||||| | |||||||| | ||||||||||||||||||   | ||||||||||||||||||||||    
4098156 tctaaatcttagaaattgtggttgggcctaacacaatcacacaaaaccggtttgtgaagagaggattgcccccacttataaaca 4098239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #87
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 660 - 739
Target Start/End: Original strand, 4098161 - 4098239
Alignment:
660 atcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    ||||||||| | ||||||||||||||||||| | |||||||| |||||||||   |||||||| ||| ||||||||||||    
4098161 atcttagaaattgtggttgggcctaacacaatcacacaaaaccggtttgtgaagagaggattg-cccccacttataaaca 4098239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #88
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 622 - 693
Target Start/End: Complemental strand, 17402706 - 17402635
Alignment:
622 gcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccc 693  Q
    |||||||| ||||||||||||| |||  ||| |||| ||||||| || ||||||| ||||||||||||||||    
17402706 gcaggtagtccaatggatcttggagatgctctgataccatcttaaaaatcgtggtcgggcctaacacaaccc 17402635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #89
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 660 - 739
Target Start/End: Original strand, 25145483 - 25145561
Alignment:
660 atcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    ||||||||| ||||||||||| ||||||||||| |||||||| |  ||||||| ||||||||| ||| |||| |||||||    
25145483 atcttagaaatcgtggttgggtctaacacaacctcacaaaaccgacttgtgaggtgaggattg-cccccactaataaaca 25145561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #90
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 439 - 514
Target Start/End: Original strand, 25145719 - 25145794
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaa 514  Q
    |||||||| || | ||||| | ||||||||||||||||| |||| ||||||| || |||||||||||||| |||||    
25145719 tcttagaaatcatggttgggcctaacacaaccccacaaatccggcttgtgaggtgaggattgcccccactaataaa 25145794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #91
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 439 - 510
Target Start/End: Complemental strand, 35772114 - 35772043
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccactta 510  Q
    |||||||| |||| ||||| | |||||||||||||||||||||| ||| ||| || ||||||||| ||||||    
35772114 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgcgaggtgaggattgcccacactta 35772043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #92
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 461 - 516
Target Start/End: Complemental strand, 38668188 - 38668133
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    ||||||||||||||||||  || ||||||||||  |||||||||||||||||||||    
38668188 taacacaaccccacaaaattggcttgtgagatgatgattgcccccacttataaaca 38668133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #93
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 441 - 516
Target Start/End: Original strand, 40316051 - 40316126
Alignment:
441 ttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||| |||| ||||||  |||||||||| ||||||||||| || |||| || |||||| |||||||||||||||    
40316051 ttagaaatcgtggttggatctaacacaacctcacaaaaccggcttatgaggtgaggattgaccccacttataaaca 40316126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #94
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 661 - 720
Target Start/End: Original strand, 42351859 - 42351918
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggat 720  Q
    |||||||| || |||||||||| |||||||| |||||||||||| ||||||| |||||||    
42351859 tcttagaaatcatggttgggcccaacacaacaccacaaaactggcttgtgaggtgaggat 42351918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #95
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 439 - 514
Target Start/End: Complemental strand, 43409891 - 43409817
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaa 514  Q
    |||||||| |||| ||||||| |||||||||||| ||||||||| ||||||| || | |||| |||||||||||||    
43409891 tcttagaaatcgtggttggacataacacaaccccccaaaaccggcttgtgaggtgagaattg-ccccacttataaa 43409817  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #96
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 429 - 516
Target Start/End: Original strand, 51459694 - 51459781
Alignment:
429 aaattctaagtcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    ||||||||  |||||||| | || ||||| | ||| |||| ||||||||||| | |||| ||||| ||||||||||||||||||||||    
51459694 aaattctagttcttagaaattgtggttgggcctaatacaatcccacaaaaccagcttgtaagatgcggattgcccccacttataaaca 51459781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #97
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 441 - 516
Target Start/End: Complemental strand, 52127803 - 52127729
Alignment:
441 ttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||| |||| ||||||| |||||||||||||||||| | | ||||||| || |||||| |||||||||||||||    
52127803 ttagaaatcgtggttggacctaacacaaccccacaaaagcagcttgtgaggtgaggattg-ccccacttataaaca 52127729  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #98
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 664 - 739
Target Start/End: Complemental strand, 52961664 - 52961590
Alignment:
664 tagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    ||||| || ||||||| ||||||||||||||| ||||| || || |||| ||||||||| ||||||||||||||||    
52961664 tagaaatcatggttggacctaacacaaccccataaaaccggcttttgaggtgaggattg-ccctcacttataaaca 52961590  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #99
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 434 - 516
Target Start/End: Complemental strand, 856071 - 855989
Alignment:
434 ctaagtcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||||||||  ||||||||| | |||||||| | ||||||||| | ||||||| || |||||| |||||| ||||||||    
856071 ctaagtcttagaaaacgtagttgggcctaacacaatctcacaaaaccagcttgtgaggtgaggattgtccccacgtataaaca 855989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #100
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 654 - 700
Target Start/End: Complemental strand, 2120169 - 2120123
Alignment:
654 gatatcatcttagaactcgtggttgggcctaacacaaccccacaaaa 700  Q
    ||||||||||||||| ||||| |||| ||||||||||||||||||||    
2120169 gatatcatcttagaaatcgtgattggacctaacacaaccccacaaaa 2120123  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #101
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 661 - 739
Target Start/End: Original strand, 2859391 - 2859468
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||| | ||||||||||||||||||||| |||| ||| || ||||||| | ||||||| ||| ||||||||||||    
2859391 tcttagaaatggtggttgggcctaacacaacctcacagaaccggcttgtgaggtaaggattg-cccccacttataaaca 2859468  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #102
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 596 - 721
Target Start/End: Original strand, 12325494 - 12325619
Alignment:
596 ggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaag-agactcagatatcatcttagaactcgtggttgggcctaacacaacccc 694  Q
    |||||||||||| | ||| ||||||||||||| |||||||||||||| | | |  |||  ||| ||| ||||||   || ||||| |||||| |||||||    
12325494 ggtggcccgataacagaa-cctgatagcaggtggcccaatggatcttaacggatgctctaataccatgttagaaactgtcgttggacctaactcaacccc 12325592  T
695 acaaaactggtttgtgagatgaggatt 721  Q
    |||||||||| ||||||| ||||||||    
12325593 acaaaactggcttgtgaggtgaggatt 12325619  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #103
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 661 - 739
Target Start/End: Original strand, 15986332 - 15986409
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||| | |||||||| |||||||||||||||||| ||  | ||||||| ||||||||| ||| ||||||||||||    
15986332 tcttagaaatggtggttggacctaacacaaccccacaataccagcttgtgaggtgaggattg-cccccacttataaaca 15986409  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #104
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 661 - 699
Target Start/End: Original strand, 20208527 - 20208565
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaa 699  Q
    |||||||| ||||||||||||||||||||||||||||||    
20208527 tcttagaaatcgtggttgggcctaacacaaccccacaaa 20208565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #105
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 439 - 517
Target Start/End: Complemental strand, 30369920 - 30369842
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaacat 517  Q
    |||||||| |||| ||||| | |||||||||||||||||||    ||||||| || |||||||||| ||||||||||||    
30369920 tcttagaaatcgtggttgggcctaacacaaccccacaaaactatcttgtgaggtgaggattgcccctacttataaacat 30369842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #106
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 439 - 505
Target Start/End: Original strand, 31432229 - 31432295
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgccccc 505  Q
    |||||||| |||| ||||| | || ||||||||||||||||||| ||||||| || |||||||||||    
31432229 tcttagaaatcgtggttgggcctagcacaaccccacaaaaccggcttgtgaggtgaggattgccccc 31432295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #107
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 660 - 738
Target Start/End: Complemental strand, 33157307 - 33157230
Alignment:
660 atcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaac 738  Q
    ||||||||| ||||| |||||||||||||||||||||||||| |  ||  ||| || |||||||||| |||||||||||    
33157307 atcttagaaatcgtgattgggcctaacacaaccccacaaaaccgacttacgaggtggggattgtccc-cacttataaac 33157230  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #108
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 439 - 516
Target Start/End: Original strand, 2859391 - 2859468
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| | || ||||| | |||||||||| |||| |||||| ||||||| |  ||||||||||||||||||||||    
2859391 tcttagaaatggtggttgggcctaacacaacctcacagaaccggcttgtgaggtaaggattgcccccacttataaaca 2859468  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #109
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 676 - 737
Target Start/End: Complemental strand, 3170071 - 3170011
Alignment:
676 ttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaa 737  Q
    ||||| |||||||||||||||||||| || ||||||| | ||||||| ||||||||||||||    
3170071 ttgggtctaacacaaccccacaaaaccggcttgtgaggtaaggattg-ccctcacttataaa 3170011  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #110
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 461 - 514
Target Start/End: Complemental strand, 3170064 - 3170011
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaa 514  Q
    |||||||||||||||||||||| ||||||| |  ||||||||| ||||||||||    
3170064 taacacaaccccacaaaaccggcttgtgaggtaaggattgccctcacttataaa 3170011  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #111
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 439 - 516
Target Start/End: Original strand, 8870909 - 8870986
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| | || ||||||| |||||||||||||||||| ||| || |||| || | |||||||| |||||||||||    
8870909 tcttagaaatggtggttggacctaacacaaccccacaaaaacggcttatgaggtgagaattgccccaacttataaaca 8870986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #112
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 467 - 516
Target Start/End: Complemental strand, 16163224 - 16163175
Alignment:
467 aaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||||||||||| ||||||| ||  |||||||||||||||||||||    
16163224 aaccccacaaaaccggattgtgaggtgaagattgcccccacttataaaca 16163175  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #113
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 439 - 516
Target Start/End: Original strand, 25145484 - 25145561
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| |||| |||||   |||||||||| ||||||||||  ||||||| || |||||||||||||| |||||||    
25145484 tcttagaaatcgtggttgggtctaacacaacctcacaaaaccgacttgtgaggtgaggattgcccccactaataaaca 25145561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #114
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 576 - 657
Target Start/End: Original strand, 40524789 - 40524870
Alignment:
576 gttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagata 657  Q
    ||||||||| ||||| ||||||||| | ||||||| |||| ||||||||| |   |||||||||||||||||| ||| ||||    
40524789 gttcgtggacataaacggtgggtggtctgatagcgaaaacttgatagcagatgaaccaatggatcttgaagaggctctgata 40524870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #115
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 673 - 722
Target Start/End: Complemental strand, 46176799 - 46176750
Alignment:
673 tggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattg 722  Q
    |||||| ||||||||||| |||||||||||| |||||||||||| |||||    
46176799 tggttgagcctaacacaaacccacaaaactgatttgtgagatgatgattg 46176750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #116
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 663 - 739
Target Start/End: Complemental strand, 52127803 - 52127729
Alignment:
663 ttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||| |||||||||| ||||||||||||||||||||   | ||||||| |||||||||  || ||||||||||||    
52127803 ttagaaatcgtggttggacctaacacaaccccacaaaagcagcttgtgaggtgaggattg--ccccacttataaaca 52127729  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #117
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 670 - 739
Target Start/End: Complemental strand, 52907460 - 52907392
Alignment:
670 tcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    ||||||||||| || |||||||||||||||||  | ||||||| ||||||||| ||| ||||||||||||    
52907460 tcgtggttgggtcttacacaaccccacaaaaccagcttgtgaggtgaggattg-cccccacttataaaca 52907392  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #118
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 659 - 739
Target Start/End: Complemental strand, 11234303 - 11234224
Alignment:
659 catcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    ||||||| || | |||||||||||||| ||||||||||||||| || || |||| |||| | |||||| ||||||||||||    
11234303 catcttataatttgtggttgggcctaatacaaccccacaaaaccggcttatgaggtgagaactgtccc-cacttataaaca 11234224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #119
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 559 - 687
Target Start/End: Original strand, 12489097 - 12489220
Alignment:
559 cagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatat 658  Q
    |||| ||||||| ||||||| ||||| ||||||||||||| || || |||||||||| |||||| |     ||||||| ||||||||||  ||| ||||     
12489097 cagccctattgggcttggtttgtggatataaatggtgggtagctcggtagcggaaacatgatagta-----cccaatgaatcttgaagatgctctgatac 12489191  T
659 catcttagaactcgtggttgggcctaaca 687  Q
    ||||||| || || |||||| | ||||||    
12489192 catcttaaaaatcatggttgagtctaaca 12489220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #120
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 696 - 740
Target Start/End: Complemental strand, 17208840 - 17208797
Alignment:
696 caaaactggtttgtgagatgaggattgtccctcacttataaacat 740  Q
    |||||| |||||||||||||||||||| |||||||||||||||||    
17208840 caaaacaggtttgtgagatgaggattg-ccctcacttataaacat 17208797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #121
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 572 - 652
Target Start/End: Complemental strand, 26229740 - 26229660
Alignment:
572 cttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactc 652  Q
    ||||||||||||| |||||||||||||| |  ||||||| || ||||||| || || || ||||||||| || ||||||||    
26229740 cttggttcgtggacataaatggtgggtgacttgatagcgaaatcctgataacaagtggctcaatggatcatggagagactc 26229660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #122
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 661 - 737
Target Start/End: Original strand, 26865357 - 26865432
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaa 737  Q
    |||||||| | ||||||| |||||| ||||||||||||||| || ||||||| || |||||| ||| ||||||||||    
26865357 tcttagaaattgtggttgagcctaatacaaccccacaaaaccggcttgtgaggtggggattg-cccccacttataaa 26865432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #123
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 461 - 517
Target Start/End: Complemental strand, 27413645 - 27413589
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaacat 517  Q
    |||||||||| || ||||||| |||||||| || |||||||| ||||||||||||||    
27413645 taacacaacctcataaaaccgatttgtgaggtgaggattgcctccacttataaacat 27413589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #124
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 440 - 516
Target Start/End: Original strand, 34264710 - 34264786
Alignment:
440 cttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    ||||||| |||| ||||||| || |||||| | ||||||| |  ||||||||||||||||  |||||||||||||||    
34264710 cttagaaatcgtggttggacctagcacaactctacaaaactgacttgtgagatgtggattatccccacttataaaca 34264786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #125
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 663 - 739
Target Start/End: Original strand, 40316051 - 40316126
Alignment:
663 ttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||| ||||||||||  ||||||||||| |||||||| || || |||| ||||||||| ||| ||||||||||||    
40316051 ttagaaatcgtggttggatctaacacaacctcacaaaaccggcttatgaggtgaggattgaccc-cacttataaaca 40316126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #126
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 460 - 516
Target Start/End: Original strand, 49316165 - 49316221
Alignment:
460 ttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||||| ||||||||| | |||||||||||  ||||| |||||||||||||||    
49316165 ttaacacaactccacaaaactgatttgtgagatgaagattgtccccacttataaaca 49316221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #127
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 461 - 516
Target Start/End: Original strand, 2859648 - 2859703
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||||| ||||||||||| ||||||| || ||||| |||||||| |||||||    
2859648 taacacaacctcacaaaaccggcttgtgaggtgaggattacccccactaataaaca 2859703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #128
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 638 - 697
Target Start/End: Original strand, 3477152 - 3477211
Alignment:
638 atcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccaca 697  Q
    |||||||||||||||  || ||||||||||| ||||| ||| |||||| |||||||||||    
3477152 atcttgaagagactcttatgtcatcttagaaatcgtgattgtgcctaatacaaccccaca 3477211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #129
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 441 - 480
Target Start/End: Complemental strand, 5572708 - 5572669
Alignment:
441 ttagaactcgtagttggacttaacacaaccccacaaaacc 480  Q
    |||||| |||||||||| ||||||||||||||||||||||    
5572708 ttagaaatcgtagttgggcttaacacaaccccacaaaacc 5572669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #130
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 461 - 512
Target Start/End: Original strand, 9146575 - 9146626
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttata 512  Q
    ||||||||||| ||||||||| |||||||| || |||||||||||| |||||    
9146575 taacacaacccaacaaaaccgttttgtgaggtgaggattgcccccagttata 9146626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #131
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 462 - 517
Target Start/End: Complemental strand, 9499307 - 9499253
Alignment:
462 aacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaacat 517  Q
    ||||||||||||||||||||| ||||||| ||  ||||||||| ||||||||||||    
9499307 aacacaaccccacaaaaccgg-ttgtgaggtgaagattgcccctacttataaacat 9499253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #132
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 670 - 709
Target Start/End: Complemental strand, 11924997 - 11924958
Alignment:
670 tcgtggttgggcctaacacaaccccacaaaactggtttgt 709  Q
    ||||||||||||||||||||||| |||||||| |||||||    
11924997 tcgtggttgggcctaacacaacctcacaaaaccggtttgt 11924958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #133
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 474 - 517
Target Start/End: Complemental strand, 17208840 - 17208797
Alignment:
474 caaaaccggtttgtgagatgtggattgcccccacttataaacat 517  Q
    |||||| ||||||||||||| ||||||||| |||||||||||||    
17208840 caaaacaggtttgtgagatgaggattgccctcacttataaacat 17208797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #134
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 461 - 516
Target Start/End: Original strand, 25137324 - 25137379
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||||||||||||||||| || |||| || |||||||||  |||||||||||    
25137324 taacacaaccccacaaaaccggcttatgaggtgaggattgcccatacttataaaca 25137379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #135
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 439 - 490
Target Start/End: Complemental strand, 25255396 - 25255345
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgag 490  Q
    |||||||| |||| ||||| | |||||||||||||||||||||| |||||||    
25255396 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgag 25255345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #136
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 461 - 516
Target Start/End: Complemental strand, 25713456 - 25713401
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    ||||||||| ||||||||| || ||||||| ||  |||||||||||||||||||||    
25713456 taacacaactccacaaaactggcttgtgaggtgacgattgcccccacttataaaca 25713401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #137
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 453 - 516
Target Start/End: Original strand, 26173469 - 26173532
Alignment:
453 gttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    ||||||| |||||||||||||||||||||| ||   || || | ||||||||||||||||||||    
26173469 gttggacctaacacaaccccacaaaaccggcttacaaggtgagaattgcccccacttataaaca 26173532  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #138
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 461 - 516
Target Start/End: Original strand, 26346989 - 26347044
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    ||||||||||||||||||| || ||||||| || |||||| | |||||||||||||    
26346989 taacacaaccccacaaaacgggcttgtgaggtgaggattgtctccacttataaaca 26347044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #139
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 661 - 740
Target Start/End: Complemental strand, 27413667 - 27413589
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaacat 740  Q
    |||||||| || |||||| ||||||||||||| || ||||| | |||||||| ||||||||| ||  |||||||||||||    
27413667 tcttagaaatcatggttgagcctaacacaacctcataaaaccgatttgtgaggtgaggattg-cctccacttataaacat 27413589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #140
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 465 - 516
Target Start/End: Original strand, 28408067 - 28408118
Alignment:
465 acaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||||||||||||| ||||||| |  |||||| |||||||||||||||    
28408067 acaaccccacaaaaccggcttgtgaggtaaggattgtccccacttataaaca 28408118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #141
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 461 - 516
Target Start/End: Original strand, 31004458 - 31004513
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||| |||||| |||||||| | ||||||| || ||||||||||||||||||||||    
31004458 taacgcaacccaacaaaaccagcttgtgaggtgaggattgcccccacttataaaca 31004513  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #142
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 661 - 740
Target Start/End: Original strand, 40188984 - 40189062
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaacat 740  Q
    |||||||| | |||||||||||| ||||||||||||||||| |  ||||||| |||||| | ||||  ||||||||||||    
40188984 tcttagaatttgtggttgggcctgacacaaccccacaaaaccgacttgtgagttgaggact-tcccctacttataaacat 40189062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #143
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 661 - 739
Target Start/End: Complemental strand, 856066 - 855989
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    ||||||||  ||| |||||||||||||||| | ||||||||  | ||||||| ||||||||||||| ||| ||||||||    
856066 tcttagaaaacgtagttgggcctaacacaatctcacaaaaccagcttgtgaggtgaggattgtccc-cacgtataaaca 855989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #144
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 661 - 739
Target Start/End: Original strand, 4112539 - 4112616
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||| ||||||||| ||||||||||| |||| ||||  || ||||||| ||| ||||| |||| |||||||||||    
4112539 tcttagaaatcgtggttgtgcctaacacaatcccataaaatcggcttgtgaggtgatgattgcccct-acttataaaca 4112616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #145
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 683 - 721
Target Start/End: Original strand, 5034336 - 5034374
Alignment:
683 taacacaaccccacaaaactggtttgtgagatgaggatt 721  Q
    ||||||||||||||||||||| |||||||||||| ||||    
5034336 taacacaaccccacaaaactgatttgtgagatgaagatt 5034374  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #146
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 661 - 695
Target Start/End: Original strand, 20208228 - 20208262
Alignment:
661 tcttagaactcgtggttgggcctaacacaacccca 695  Q
    |||||||| ||||||||||||||||||||||||||    
20208228 tcttagaaatcgtggttgggcctaacacaacccca 20208262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #147
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 470 - 516
Target Start/End: Original strand, 26173254 - 26173300
Alignment:
470 cccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    ||||||||||||| ||||||| ||  |||||||||||||||||||||    
26173254 cccacaaaaccggcttgtgaggtgatgattgcccccacttataaaca 26173300  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #148
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 670 - 739
Target Start/End: Original strand, 28408047 - 28408118
Alignment:
670 tcgtggttgggcctaac---acaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    ||||||||||||||| |   ||||||||||||||| || ||||||| | ||||||||||| ||||||||||||    
28408047 tcgtggttgggcctagcctaacaaccccacaaaaccggcttgtgaggtaaggattgtccc-cacttataaaca 28408118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #149
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 439 - 509
Target Start/End: Complemental strand, 29266038 - 29265968
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccactt 509  Q
    |||||||| |||| ||||| | |||||||||||||||||||| | |||| || || | |||||||||||||    
29266038 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccagcttgtaaggtgagtattgcccccactt 29265968  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #150
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 661 - 739
Target Start/End: Original strand, 39348118 - 39348195
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||| ||||||||||| |||||||||||||||| ||| || | || || ||||||||| ||  ||||||||||||    
39348118 tcttagaaatcgtggttgggtctaacacaaccccacagaaccggctggtaagttgaggattg-cctccacttataaaca 39348195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #151
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 660 - 722
Target Start/End: Complemental strand, 43409892 - 43409830
Alignment:
660 atcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattg 722  Q
    ||||||||| |||||||||| | |||||||||||| |||||| || ||||||| |||| ||||    
43409892 atcttagaaatcgtggttggacataacacaaccccccaaaaccggcttgtgaggtgagaattg 43409830  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #152
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 564 - 701
Target Start/End: Complemental strand, 49142898 - 49142761
Alignment:
564 ctattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaag-agactcagatatcatc 662  Q
    |||||||  |||||||||||| |||| ||||||||  ||||||||| ||||||||||||  | |  ||||||||||||| | | || ||| || ||||||    
49142898 ctattgggtttggttcgtggacataa-tggtgggtaccccgatagcagaaacctgatagttgatgtcccaatggatcttaatgaaggctctgaaatcatc 49142800  T
663 ttagaactcgtggttgggcctaacacaaccccacaaaac 701  Q
     ||||| | |||||||  |||||| |||| |||||||||    
49142799 atagaaatggtggttgaacctaactcaactccacaaaac 49142761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #153
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 461 - 515
Target Start/End: Original strand, 50695855 - 50695909
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaac 515  Q
    |||| ||||||||||||||||| ||||||| || ||||| ||| |||||||||||    
50695855 taactcaaccccacaaaaccggcttgtgagctgaggattaccctcacttataaac 50695909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #154
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 659 - 737
Target Start/End: Complemental strand, 50882751 - 50882674
Alignment:
659 catcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaa 737  Q
    ||||||| || || |||||||||| || ||||| ||||||||| |  ||||||||||||||||||  ||||||||||||    
50882751 catcttaaaaatcttggttgggccgaatacaactccacaaaaccgacttgtgagatgaggattgt-tctcacttataaa 50882674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #155
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 661 - 739
Target Start/End: Original strand, 51459704 - 51459781
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||| | |||||||||||||| |||| ||||||||||  | |||| ||||| |||||| ||| ||||||||||||    
51459704 tcttagaaattgtggttgggcctaatacaatcccacaaaaccagcttgtaagatgcggattg-cccccacttataaaca 51459781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #156
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 550 - 599
Target Start/End: Complemental strand, 769020 - 768971
Alignment:
550 cctcacaaccagcactattggacttggttcgtggaaataaatggtgggtg 599  Q
    |||||| || |||||||||||| ||| |||||||| ||||||||||||||    
769020 cctcacgactagcactattggatttgattcgtggacataaatggtgggtg 768971  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #157
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 654 - 727
Target Start/End: Complemental strand, 11525089 - 11525016
Alignment:
654 gatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccct 727  Q
    |||| |||||||||| | |||| |||||||||||||||| |||||||| || ||||| | |||| |||| ||||    
11525089 gataccatcttagaaattgtggatgggcctaacacaacctcacaaaaccggattgtggggtgagcattgcccct 11525016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #158
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 448 - 517
Target Start/End: Complemental strand, 11924997 - 11924928
Alignment:
448 tcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaacat 517  Q
    |||| ||||| | |||||||||| |||||||||||||||| || || | | | |||||||||||||||||    
11924997 tcgtggttgggcctaacacaacctcacaaaaccggtttgtaaggtgagaaatacccccacttataaacat 11924928  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #159
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 439 - 516
Target Start/End: Original strand, 20208527 - 20208602
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| |||| ||||| | |||||||||||||| |||||||  | |||| || ||||||||||||||||||||||    
20208527 tcttagaaatcgtggttgggcctaacacaaccccac-aaaccgg-ctatgaggtgaggattgcccccacttataaaca 20208602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #160
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 439 - 516
Target Start/End: Complemental strand, 29898997 - 29898920
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| |||| ||||| | || ||||||| ||||||||||| ||||| | || | ||||||| ||||||||||||    
29898997 tcttagaaatcgtggttgggcctagcacaacctcacaaaaccggcttgtgtggtgagaattgccctcacttataaaca 29898920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #161
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 463 - 516
Target Start/End: Complemental strand, 32223824 - 32223771
Alignment:
463 acacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    ||||||||||||| ||| || |||||||||| |||| |||||||| ||||||||    
32223824 acacaaccccacacaactggcttgtgagatgaggatcgcccccacatataaaca 32223771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #162
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 439 - 504
Target Start/End: Original strand, 42586438 - 42586503
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccc 504  Q
    |||||||| |||| ||||| | ||||||||||||||||||  || ||||||| || ||||||||||    
42586438 tcttagaaatcgtggttgggcctaacacaaccccacaaaattggcttgtgaggtgaggattgcccc 42586503  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 138; Significance: 1e-71; HSPs: 127)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 138; E-Value: 1e-71
Query Start/End: Original strand, 439 - 739
Target Start/End: Original strand, 40379208 - 40379520
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca-------------tcttatatt 525  Q
    |||||||| |||| ||||| | |||||||||||||||||||||| ||||||| || ||||||||||||||||||||||             ||   |||     
40379208 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacactgtcaggccatcacctatc 40379307  T
526 cgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcag 625  Q
    ||||||||||| ||||| ||||| |||||| ||||||||| |||| ||||||||||||| ||||||||||||||||||||||| ||||||||||||||||    
40379308 cgatgtgggactcttaacacacctcctcacgaccagcacttttgggcttggttcgtggatataaatggtgggtggcccgatagaggaaacctgatagcag 40379407  T
626 gtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtcc 725  Q
    || ||| ||||||||||| | || ||| |||| |||||||||| |||||||||||||||||||||||||||||||| || ||||||| ||||||||| ||    
40379408 gtggcctaatggatcttggaaaggctctgataccatcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattg-cc 40379506  T
726 ctcacttataaaca 739  Q
    | ||||||||||||    
40379507 cccacttataaaca 40379520  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 134; E-Value: 3e-69
Query Start/End: Original strand, 439 - 719
Target Start/End: Complemental strand, 16419587 - 16419294
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaacatcttat-------------att 525  Q
    |||||||| |||| ||||| | |||||||||||||||||||||| ||||||| || ||||||||||||||||||||||  || |             ||     
16419587 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcagaccatgtcctatc 16419488  T
526 cgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcag 625  Q
    ||||||||||| ||||| ||||| |||||| |||||||||||||  ||||||||||||| |||||||||||||||| |||||||||||||||||||||||    
16419487 cgatgtgggactcttaacacaccccctcacgaccagcactattgagcttggttcgtggacataaatggtgggtggctcgatagcggaaacctgatagcag 16419388  T
626 gtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgagga 719  Q
    || ||||||||||||||| |||| ||| |||| |||||||||| |||||||||||||||| ||||||||||||||| || ||||||| ||||||    
16419387 gtggcccaatggatcttggagaggctctgataccatcttagaaatcgtggttgggcctaatacaaccccacaaaaccggcttgtgaggtgagga 16419294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 130; E-Value: 6e-67
Query Start/End: Original strand, 439 - 739
Target Start/End: Complemental strand, 2030089 - 2029777
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaacatctt-------------atatt 525  Q
    |||||||| |||| ||||| | ||| |||||||||||||||||| ||||||| || |||||||| |||||||||||||  ||             || |     
2030089 tcttagaaatcgtggttgggcctaaaacaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaacacattgtcaggtcatgtcatgtc 2029990  T
526 cgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcag 625  Q
    ||||||||||| ||||| ||||| |||||| |||||||||||||| ||||||||||||| ||||||||||||||| |||||||||||||||| |||||||    
2029989 cgatgtgggactcttaacacaccccctcacgaccagcactattgggcttggttcgtggacataaatggtgggtggtccgatagcggaaacctaatagcag 2029890  T
626 gtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtcc 725  Q
    || ||||||||||||||| |||| ||| |||| |||||||||| |||||||||||||||| ||||||||||||||| || ||||||| ||||||||| ||    
2029889 gtggcccaatggatcttggagaggctctgataccatcttagaaatcgtggttgggcctaaaacaaccccacaaaaccggcttgtgaggtgaggattg-cc 2029791  T
726 ctcacttataaaca 739  Q
      ||||||||||||    
2029790 tccacttataaaca 2029777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 120; E-Value: 6e-61
Query Start/End: Original strand, 461 - 739
Target Start/End: Original strand, 15124569 - 15124859
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaacatcttat-------------attcgatgtgggacgcttaatacac 547  Q
    |||||||||||||||||| ||| || |||| || ||||||||||||||||||||||| || |             || ||||||||||| ||||| |||     
15124569 taacacaaccccacaaaatcggcttatgaggtggggattgcccccacttataaacatattgtcagaccatgttctatccgatgtgggactcttaacacat 15124668  T
548 cacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaaga 647  Q
    | ||||||||||||||||||||||||||||||||||| ||||||||||| || ||||||| || |||||||||||||||| | ||||||||||||| |||    
15124669 cccctcacaaccagcactattggacttggttcgtggacataaatggtggatgacccgataacgaaaacctgatagcaggtggtccaatggatcttggaga 15124768  T
648 gactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    ||||| |||| |||||||||| ||||||||||| |||||||||||||||||||| |  ||||||  ||| ||||| ||||||||||||||||    
15124769 gactctgataccatcttagaaatcgtggttgggtctaacacaaccccacaaaaccgaattgtgaagtgaagattg-ccctcacttataaaca 15124859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 118; E-Value: 9e-60
Query Start/End: Original strand, 526 - 739
Target Start/End: Original strand, 14466274 - 14466486
Alignment:
526 cgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcag 625  Q
    |||||||| || ||||| ||||| |||||| |||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||| ||     
14466274 cgatgtggaactcttaacacaccccctcacgaccagcactattgggcttggttcgtggacataaatggtgggtggcccgatagcggaaacctgataacaa 14466373  T
626 gtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtcc 725  Q
    || ||||||||||||||| |||| ||| |||| |||||||||| | |||||||||||||||||||||||||||||| || |||| || ||||||||| |     
14466374 gtggcccaatggatcttggagaggctctgataccatcttagaaatggtggttgggcctaacacaaccccacaaaaccggcttgtaaggtgaggattg-ct 14466472  T
726 ctcacttataaaca 739  Q
    | ||||||||||||    
14466473 cccacttataaaca 14466486  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 118; E-Value: 9e-60
Query Start/End: Original strand, 526 - 739
Target Start/End: Original strand, 33606153 - 33606365
Alignment:
526 cgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcag 625  Q
    ||||||||||| ||||| |||||||||||| |||| ||||||| | ||||||||||||| ||||||||||||||||| |||||||||||||||||||||     
33606153 cgatgtgggactcttaacacaccacctcacgaccatcactattaggcttggttcgtggacataaatggtgggtggcctgatagcggaaacctgatagcaa 33606252  T
626 gtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtcc 725  Q
    ||  |||||| |||||||||||||||  ||||||||||||||| ||||||||| |||||||| ||| |||||||||||| ||||||| ||||||||  ||    
33606253 gtgacccaatagatcttgaagagactttgatatcatcttagaaatcgtggttgtgcctaacataacgccacaaaactggcttgtgaggtgaggatt-acc 33606351  T
726 ctcacttataaaca 739  Q
    | ||||||||||||    
33606352 cccacttataaaca 33606365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 110; E-Value: 5e-55
Query Start/End: Original strand, 439 - 739
Target Start/End: Original strand, 5711438 - 5711751
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaacatcttat------att------- 525  Q
    |||||||| |||| ||||| | |||||||||||||||||||||| |||| || || ||||||||||||||||||||||  || |      |||           
5711438 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgttaggtgaggattgcccccacttataaacacattgtcaggccatttcctttc 5711537  T
526 cgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcag 625  Q
    ||||||||||| ||||| ||||| |||||| |||||||||||||| ||||||||||||| |||||||||||||||||||||| |||||||||||||||||    
5711538 cgatgtgggactcttaacacaccccctcacgaccagcactattgggcttggttcgtggacataaatggtgggtggcccgataacggaaacctgatagcag 5711637  T
626 gtagcccaatggatctt-gaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtc 724  Q
    || | |||| ||||||| || ||| ||| ||||  ||||||||| | |||||||||||||||||||||||||||||| || || | || ||| ||||| |    
5711638 gtggtccaacggatcttggaggaggctctgatactatcttagaaatggtggttgggcctaacacaaccccacaaaaccggcttttaaggtgatgattg-c 5711736  T
725 cctcacttataaaca 739  Q
    || ||||||||||||    
5711737 ccccacttataaaca 5711751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 97; E-Value: 3e-47
Query Start/End: Original strand, 533 - 701
Target Start/End: Complemental strand, 16533525 - 16533357
Alignment:
533 ggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagccc 632  Q
    |||| ||||| |||||  ||||| |||||||||||||| ||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||    
16533525 ggactcttaacacaccctctcacgaccagcactattggccttggttcgtggacataaatggtgggtggcccgatagcgaaaacctgatagcaggtagccc 16533426  T
633 aatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaac 701  Q
    |||||||||||||||| ||| |||| ||| |||||| |||| ||||||  |||||||||| || |||||    
16533425 aatggatcttgaagaggctctgataccattttagaagtcgtagttgggtgtaacacaacctcataaaac 16533357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 96; E-Value: 1e-46
Query Start/End: Original strand, 453 - 690
Target Start/End: Original strand, 40149016 - 40149264
Alignment:
453 gttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca-------------tcttatattcgatgtgggacgct 539  Q
    ||||||| |||||||||||||||||| ||| ||||||| || |||||| |||||||||||||||             |||| ||| ||||||| ||| ||    
40149016 gttggacctaacacaaccccacaaaatcggcttgtgaggtgaggattgtccccacttataaacacactgttaggtcatcttctatccgatgtgagactct 40149115  T
540 taatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggat 639  Q
    ||| |||||  ||||| |||||||||||||| ||||||||||||| |||||| |||||||| |||||||| |||| ||||||||||||  ||||||||||    
40149116 taacacacc--ctcacgaccagcactattgggcttggttcgtggacataaatagtgggtggtccgatagctgaaatctgatagcaggtgacccaatggat 40149213  T
640 cttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaa 690  Q
    ||||||||| ||| |||| |||||||||| | |||||||||||||||||||    
40149214 cttgaagaggctctgataccatcttagaaattgtggttgggcctaacacaa 40149264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 94; E-Value: 2e-45
Query Start/End: Original strand, 548 - 701
Target Start/End: Original strand, 93240 - 93393
Alignment:
548 cacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaaga 647  Q
    |||| ||| |||||||||||||| |||| |||||||| |||| ||||||||||||||||| |||||| |||||||||||| ||||||||||||||| |||    
93240 caccccacgaccagcactattgggcttgattcgtggacataattggtgggtggcccgataacggaaagctgatagcaggtggcccaatggatcttggaga 93339  T
648 gactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaac 701  Q
    | ||| |||| ||||||| || ||||||||||||||||||||||||||||||||    
93340 ggctctgataccatcttaaaaatcgtggttgggcctaacacaaccccacaaaac 93393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 93; E-Value: 7e-45
Query Start/End: Original strand, 526 - 739
Target Start/End: Original strand, 17525198 - 17525414
Alignment:
526 cgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcag 625  Q
    ||||||| |||  |||| |||||  ||||| |||| ||||||||| ||||||||||||| ||||||||||||||||||||||||||| ||||||||||||    
17525198 cgatgtgagacttttaacacacccactcacgaccatcactattgggcttggttcgtggacataaatggtgggtggcccgatagcggatacctgatagcag 17525297  T
626 gtagcccaatggatcttgaagagactcagatatcatcttagaa------ctcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgagga 719  Q
    || ||||||||||| |||||||| |||  ||||||||||||||      ||||||||||||||| |||||| |||||||||| || ||||||| ||||||    
17525298 gtggcccaatggat-ttgaagaggctcttatatcatcttagaattcattctcgtggttgggcct-acacaatcccacaaaaccggcttgtgaggtgagga 17525395  T
720 ttgtccctcacttataaaca 739  Q
    ||| ||| ||||||||||||    
17525396 ttg-cccccacttataaaca 17525414  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 88; E-Value: 7e-42
Query Start/End: Original strand, 572 - 739
Target Start/End: Complemental strand, 17719574 - 17719408
Alignment:
572 cttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactc 671  Q
    ||||||||||||| ||||||||||| ||||| ||||| |||||||||||||||||| ||| ||||||||||| |||||||  |||| |||||||||| |     
17719574 cttggttcgtggacataaatggtggatggccggataggggaaacctgatagcaggtggccaaatggatcttggagagactttgataccatcttagaaatt 17719475  T
672 gtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    ||||||||||| |||||||||| ||||||| || ||||||| ||||||||| ||| ||||||||||||    
17719474 gtggttgggccgaacacaacccgacaaaaccggcttgtgaggtgaggattg-cccccacttataaaca 17719408  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 87; E-Value: 3e-41
Query Start/End: Original strand, 515 - 722
Target Start/End: Complemental strand, 24396096 - 24395887
Alignment:
515 catcttatattcgatgtgggacgcttaatacaccacctcacaaccagcactattgga--cttggttcgtggaaataaatggtgggtggcccgatagcgga 612  Q
    |||||||||| ||||||||||| ||||| ||||| |||||  |||| ||| |||||   |||||||| |||| ||||||||||||||| ||||||| | |    
24396096 catcttatatccgatgtgggactcttaacacaccccctcatgaccaacaccattgggggcttggttcatggacataaatggtgggtggtccgatagtgaa 24395997  T
613 aacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgag 712  Q
    ||| ||| ||||||| | |||||||||||||||||| ||| |||| | |||||||| |||||||| ||||||||||||||||||||||  | ||||||||    
24395996 aacatgagagcaggtggtccaatggatcttgaagaggctctgataccctcttagaaatcgtggtttggcctaacacaaccccacaaaatcgatttgtgag 24395897  T
713 atgaggattg 722  Q
     |||||||||    
24395896 gtgaggattg 24395887  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 83; E-Value: 7e-39
Query Start/End: Original strand, 538 - 739
Target Start/End: Original strand, 36352037 - 36352235
Alignment:
538 cttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatgg 637  Q
    ||||| ||||| | |||| |||| ||||||||| ||| |||||||||  ||||||||||||||||||||| ||||||||||||| ||||| |||| ||||    
36352037 cttaacacaccccatcacgaccaacactattgggcttcgttcgtgga--taaatggtgggtggcccgataacggaaacctgataacaggtggcccgatgg 36352134  T
638 atcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaa 737  Q
    |||||||||||||||  ||| ||||||| || | |||||||  ||||||||||||||||||||| || || |||| ||| ||||| ||| ||||||||||    
36352135 atcttgaagagactctaataccatcttaaaaattgtggttgaacctaacacaaccccacaaaaccggcttttgaggtgatgattg-cccccacttataaa 36352233  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 80; E-Value: 4e-37
Query Start/End: Original strand, 526 - 739
Target Start/End: Complemental strand, 32356601 - 32356394
Alignment:
526 cgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcag 625  Q
    |||||||| || ||||||||||   |||||||||| |||||||    |||||||||||| ||||||||| ||| ||||||||||||||||||||  ||||    
32356601 cgatgtggaactcttaatacact--ctcacaaccaacactattcagtttggttcgtggacataaatggtaggtagcccgatagcggaaacctga--gcag 32356506  T
626 gtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtcc 725  Q
    || |||||||| || |||||||| ||| |||| || ||||||| |||| ||||||||||||||||| |||||||||||| ||||| | ||||||||| ||    
32356505 gtggcccaatgaatattgaagaggctctgataccaacttagaattcgtagttgggcctaacacaactccacaaaactggcttgtg-ggtgaggattg-cc 32356408  T
726 ctcacttataaaca 739  Q
    | ||||||||||||    
32356407 cccacttataaaca 32356394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 76; E-Value: 1e-34
Query Start/End: Original strand, 526 - 657
Target Start/End: Original strand, 37812367 - 37812498
Alignment:
526 cgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcag 625  Q
    ||||||||||| ||||| ||||| |||||| ||||||| |||||| ||||||||||||| |||||  ||||||||||||||||| |||||||||||||||    
37812367 cgatgtgggactcttaacacaccccctcacgaccagcattattgggcttggttcgtggacataaacagtgggtggcccgatagcagaaacctgatagcag 37812466  T
626 gtagcccaatggatcttgaagagactcagata 657  Q
    || ||||||||||||||| |||| ||| ||||    
37812467 gtggcccaatggatcttggagaggctccgata 37812498  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 70; E-Value: 4e-31
Query Start/End: Original strand, 586 - 739
Target Start/End: Complemental strand, 2324400 - 2324248
Alignment:
586 ataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaa 685  Q
    |||||||  ||||||||||||| ||||||||||||| ||||| ||||||   ||| ||||||| ||| |||| ||| ||| || ||||||||||||||||    
2324400 ataaatgacgggtggcccgataacggaaacctgataacaggtggcccaaacaatcgtgaagaggctctgataccatattaaaaatcgtggttgggcctaa 2324301  T
686 cacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||||||||||| || ||||||| ||||||||| ||| ||||||||||||    
2324300 cacaaccccacaaaaccggcttgtgaggtgaggattg-cccccacttataaaca 2324248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 587 - 740
Target Start/End: Complemental strand, 13210686 - 13210533
Alignment:
587 taaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatctt-gaagagactcagatatcatcttagaactcgtggttgggcctaa 685  Q
    |||||||||||| ||||||||| ||||| ||||||||| || |||||||||||||| || ||| ||| |||| |||||||||| | ||||||||||||||    
13210686 taaatggtgggttgcccgatagaggaaatctgatagcatgtggcccaatggatcttggaggagtctctgataccatcttagaatttgtggttgggcctaa 13210587  T
686 cacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaacat 740  Q
    ||| |||||||||||| |   |||||| ||||||||| ||||| |||||||||||    
13210586 cacgaccccacaaaaccgacctgtgaggtgaggattg-ccctctcttataaacat 13210533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 66; E-Value: 1e-28
Query Start/End: Original strand, 586 - 739
Target Start/End: Complemental strand, 5509239 - 5509087
Alignment:
586 ataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaa 685  Q
    |||||||  ||||||||||||| ||||||||||||| ||||| |||||| | ||| ||||||| ||| |||| ||| |||||| || |||||||||||||    
5509239 ataaatgacgggtggcccgataacggaaacctgataacaggtggcccaaagaatcgtgaagaggctctgataccatattagaaatcatggttgggcctaa 5509140  T
686 cacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    ||||||||||||||||  | ||||||| ||||||||  ||| ||||||||||||    
5509139 cacaaccccacaaaaccagcttgtgaggtgaggatt-acccccacttataaaca 5509087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 66; E-Value: 1e-28
Query Start/End: Original strand, 586 - 739
Target Start/End: Original strand, 17854853 - 17855005
Alignment:
586 ataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaa 685  Q
    |||||||  |||||||||| || | ||||||| ||| ||||| ||| || | ||| ||||||||||| |||||||| |||||| ||||||||||| |||     
17854853 ataaatgacgggtggcccggtaacagaaacctaataacaggtggcctaaagaatcgtgaagagactctgatatcatattagaaatcgtggttgggtctag 17854952  T
686 cacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||||||||||| || ||||||| ||||||||| ||||||||||||||||    
17854953 cacaaccccacaaaaccggcttgtgaggtgaggattg-ccctcacttataaaca 17855005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 65; E-Value: 4e-28
Query Start/End: Original strand, 593 - 701
Target Start/End: Original strand, 93558 - 93666
Alignment:
593 gtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaacc 692  Q
    ||||||||||||||| |||||||||||||| ||||  |||||||||||||| | ||  || |||| |||||||||| |||||||||||||||||||||||    
93558 gtgggtggcccgataacggaaacctgatagtaggtgacccaatggatcttggaaaggttctgataccatcttagaaatcgtggttgggcctaacacaacc 93657  T
693 ccacaaaac 701  Q
    |||||||||    
93658 ccacaaaac 93666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 65; E-Value: 4e-28
Query Start/End: Original strand, 44 - 327
Target Start/End: Original strand, 30562426 - 30562694
Alignment:
44 gtttgtagctttttgaagtcactgtagaatgacattgagacgcgatgcctctgcaaagaagatggtttccaaacataagctaattcatatctcacactat 143  Q
    |||||||||||||| | |||||  |||||||||||||||||  ||  | ||||| |||||||||| ||||||||||||||||||||||||              
30562426 gtttgtagctttttaatgtcaccctagaatgacattgagacatgacacgtctgcgaagaagatggattccaaacataagctaattcatat---------- 30562515  T
144 tgacttcaaaggctctttcctttcatgtcttttaaagaaaggctcttcagtaaaattgcagtgttt--gcaggttggtataatggtatcaccatgtatca 241  Q
        |||| | | |||||||| ||||||| ||| || |||  |||||||||||||||||| |||||  ||   |||| |  | |||||||||| | ||||    
30562516 ----ttcagatgatctttcctgtcatgtcatttgaataaatcctcttcagtaaaattgcaatgtttttgcctattggca--acggtatcaccaagaatca 30562609  T
242 actacacacaaagaggtttcttttaatgtcacaataataagaagtaaaataaccaaaatttcatgtacctgataaatcatctgttg 327  Q
    |||||||||||||  || | |||||||||||||||||||||||  | |||||||||||||||| ||||||||||||| ||||||||    
30562610 actacacacaaagctgtat-ttttaatgtcacaataataagaaacataataaccaaaatttcaagtacctgataaattatctgttg 30562694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 60; E-Value: 4e-25
Query Start/End: Original strand, 522 - 652
Target Start/End: Original strand, 44404021 - 44404152
Alignment:
522 tattcgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatag-cggaaacctgat 620  Q
    ||||||||||  ||| ||||| ||||| | |||| |||| ||||||||| |||||||| |||| |||||| ||||||| |||||||| ||||||||||||    
44404021 tattcgatgtatgactcttaacacaccccatcacgaccaacactattgggcttggttcatggacataaatagtgggtgacccgataggcggaaacctgat 44404120  T
621 agcaggtagcccaatggatcttgaagagactc 652  Q
    ||||||| | ||||||||||||| ||||||||    
44404121 agcaggtggtccaatggatcttggagagactc 44404152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #24
Raw Score: 58; E-Value: 6e-24
Query Start/End: Original strand, 560 - 657
Target Start/End: Original strand, 18607142 - 18607239
Alignment:
560 agcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagata 657  Q
    ||||||||||| |||||||||| || ||||||||||||| |||||||| |||||||||||||||| || ||||||||||||||| |||| ||| ||||    
18607142 agcactattgggcttggttcgtagacataaatggtgggttgcccgataacggaaacctgatagcatgtggcccaatggatcttggagaggctctgata 18607239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #25
Raw Score: 58; E-Value: 6e-24
Query Start/End: Original strand, 572 - 712
Target Start/End: Original strand, 21383579 - 21383720
Alignment:
572 cttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaag-agactcagatatcatcttagaact 670  Q
    |||||| | |||| |||||| ||||||| ||| ||||| ||||| ||||||||||| ||||||  ||||||| || || ||| |||| |||||||||| |    
21383579 cttggtgcctggatataaattgtgggtgacccaatagcagaaacttgatagcaggtggcccaacagatcttggaggaggctctgataccatcttagaaat 21383678  T
671 cgtggttgggcctaacacaaccccacaaaactggtttgtgag 712  Q
    |||||||||||||||| ||| |||||||||| ||||||||||    
21383679 cgtggttgggcctaactcaatcccacaaaaccggtttgtgag 21383720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #26
Raw Score: 58; E-Value: 6e-24
Query Start/End: Original strand, 572 - 665
Target Start/End: Complemental strand, 34893599 - 34893506
Alignment:
572 cttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatctta 665  Q
    ||||||||||||| ||||||||||||||| ||||||||| ||||||||||| |||| ||||||||||||||| |||| ||| |||| |||||||    
34893599 cttggttcgtggacataaatggtgggtggtccgatagcgaaaacctgatagtaggtggcccaatggatcttggagaggctctgataccatctta 34893506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #27
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 550 - 702
Target Start/End: Original strand, 33381076 - 33381231
Alignment:
550 cctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccga--tagcggaaacctgatagcaggtagcccaatggatcttgaag- 646  Q
    |||||| |||||||||| |||  |||||||||||| ||||||| |||||| | |||  |||| |||||||| ||||| || ||| |||| |||||||||     
33381076 cctcacgaccagcactactgggtttggttcgtggacataaatgatgggtgactcgagatagcagaaacctgttagcatgtggcctaatgaatcttgaagg 33381175  T
647 agactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaact 702  Q
    ||||||  ||| |||||||||| ||||||||||| ||||||||||| |||||||||    
33381176 agactctaataccatcttagaaatcgtggttgggactaacacaacctcacaaaact 33381231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #28
Raw Score: 55; E-Value: 4e-22
Query Start/End: Original strand, 586 - 739
Target Start/End: Original strand, 28407716 - 28407869
Alignment:
586 ataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaag-agactcagatatcatcttagaactcgtggttgggccta 684  Q
    |||||||  ||||||||||||| |||||| |||| | |||||  ||||| | ||| ||||  || ||| |||| |||||||||| |||||||||||||||    
28407716 ataaatgacgggtggcccgataacggaaatctgacaacaggtgacccaaagaatcgtgaaccaggctctgataccatcttagaaatcgtggttgggccta 28407815  T
685 acacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    ||||||| ||||||||| || ||||||| ||||||||| ||| ||||||||||||    
28407816 acacaactccacaaaaccggcttgtgaggtgaggattg-cccccacttataaaca 28407869  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #29
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 630 - 739
Target Start/End: Complemental strand, 29718444 - 29718336
Alignment:
630 cccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctca 729  Q
    |||||||||| ||  |||| ||| |||| || ||||||| |||||||| ||||||||||||||||||||||| || ||||||| ||||||||| ||||||    
29718444 cccaatggattttagagaggctctgataccaacttagaaatcgtggttaggcctaacacaaccccacaaaaccggcttgtgaggtgaggattg-ccctca 29718346  T
730 cttataaaca 739  Q
    ||||||||||    
29718345 cttataaaca 29718336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #30
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 663 - 739
Target Start/End: Original strand, 19191611 - 19191686
Alignment:
663 ttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||| |||||||||||||||||||||||||||||||| || ||||||| ||||||||||||| ||||||||||||    
19191611 ttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgtccc-cacttataaaca 19191686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #31
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 617 - 739
Target Start/End: Original strand, 27897561 - 27897681
Alignment:
617 tgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatga 716  Q
    ||||| |||||||||||| | ||| ||||||||||  |||| |||||||||| | |||||||||||||||||||||||||||||| |  ||||||| |||    
27897561 tgataacaggtagcccaaagaatcgtgaagagactttgataccatcttagaaatggtggttgggcctaacacaaccccacaaaaccgacttgtgaggtga 27897660  T
717 ggattgtccctcacttataaaca 739  Q
    | ||||  || ||||||||||||    
27897661 gaattg--ccccacttataaaca 27897681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #32
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 661 - 739
Target Start/End: Complemental strand, 16419587 - 16419510
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||| |||||||||||||||||||||||||||||||| || ||||||| ||||||||| ||| ||||||||||||    
16419587 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattg-cccccacttataaaca 16419510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #33
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 570 - 652
Target Start/End: Original strand, 30701166 - 30701248
Alignment:
570 gacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactc 652  Q
    ||||||||| ||||| ||||||||||| |||||||||||   ||||||||||| |||| ||||||||||||||||||||||||    
30701166 gacttggtttgtggacataaatggtggatggcccgatagaaaaaacctgatagtaggtggcccaatggatcttgaagagactc 30701248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #34
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 579 - 724
Target Start/End: Complemental strand, 10523185 - 10523041
Alignment:
579 cgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttg 678  Q
    |||||| |||||||||||||||| ||||| ||||||| |||||||||||  |||||  ||||||| || ||  |  ||| ||| |||||| |||||||||    
10523185 cgtggacataaatggtgggtggctcgataacggaaacttgatagcaggtgacccaacagatcttggag-gaggctaataccattttagaaatcgtggttg 10523087  T
679 ggcctaacacaaccccacaaaactggtttgtgagatgaggattgtc 724  Q
    |||||||||||| ||||||||| ||| ||| ||| ||| |||||||    
10523086 ggcctaacacaatcccacaaaaatggcttgcgaggtgaagattgtc 10523041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #35
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 661 - 738
Target Start/End: Complemental strand, 17719651 - 17719575
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaac 738  Q
    |||||||| |||||||||||||||||||||||||||||||| |||||||||| | ||||||| ||| |||||||||||    
17719651 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggtttgtgaggtcaggattg-cccccacttataaac 17719575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #36
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 26 - 194
Target Start/End: Original strand, 30553965 - 30554134
Alignment:
26 ggcaaggtcaaagctcgagtttgtagcttttt-gaagtcactgtagaatgacattgagacgcgatgcctctgcaaagaagatggtttccaaacataagct 124  Q
    ||||||||| |||||||||||||||||||    ||||||||  |||||||||||||||||| |  | |||   ||||||| || ||| ||||||||  |     
30553965 ggcaaggtccaagctcgagtttgtagcttcaacgaagtcacgatagaatgacattgagacgtggcgtctcgataaagaagttgattttcaaacatacacc 30554064  T
125 aattcatatctcacactattgacttcaaaggctctttcctttcatgtcttttaaagaaaggctcttcagt 194  Q
    ||||||| || || ||||||||||||||||  | |||||||||| ||||||| ||| |||||||||||||    
30554065 aattcatgtcccatactattgacttcaaagattttttcctttcacgtcttttcaaggaaggctcttcagt 30554134  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #37
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 439 - 515
Target Start/End: Complemental strand, 17719651 - 17719575
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaac 515  Q
    |||||||| |||| ||||| | |||||||||||||||||||||||||||||| |  |||||||||||||||||||||    
17719651 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggtttgtgaggtcaggattgcccccacttataaac 17719575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #38
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 448 - 516
Target Start/End: Complemental strand, 32884183 - 32884115
Alignment:
448 tcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||||| | |||||||||||||||||||||| ||||||| || ||||||||||||||||||||||    
32884183 tcgtagttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaaca 32884115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #39
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 550 - 701
Target Start/End: Original strand, 13250145 - 13250296
Alignment:
550 cctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagaga 649  Q
    |||||| |||| ||||||||| | || |||||||| |||||||||||||| ||| ||||| ||||||| |||  ||||  |||||||||||||| | |      
13250145 cctcacgaccatcactattgggcatgcttcgtggacataaatggtgggtgccccaatagcagaaaccttataaaaggtgacccaatggatcttggaaaag 13250244  T
650 ctcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaac 701  Q
    |||  |||||||||||||| ||||  |||| ||||||||| || ||||||||    
13250245 ctctaatatcatcttagaaatcgtatttggacctaacacatcctcacaaaac 13250296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #40
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 661 - 739
Target Start/End: Original strand, 25082536 - 25082613
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||| |||||||||| |||||||||||||||||||||||| ||||||| ||| ||||| |||| |||||||||||    
25082536 tcttagaaatcgtggttggacctaacacaaccccacaaaactggcttgtgaggtgatgattgcccct-acttataaaca 25082613  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #41
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 658 - 739
Target Start/End: Complemental strand, 2030092 - 2030012
Alignment:
658 tcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    ||||||||||| |||||||||||||||| ||||||||||||||| || ||||||| ||||||||| ||  ||||||||||||    
2030092 tcatcttagaaatcgtggttgggcctaaaacaaccccacaaaaccggcttgtgaggtgaggattg-cctccacttataaaca 2030012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #42
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 611 - 739
Target Start/End: Complemental strand, 14927238 - 14927110
Alignment:
611 gaaacctgatagcaggtagcccaatggatcttgaag-agactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgt 709  Q
    |||||||||||||||||  ||||| ||||| ||||| || ||| ||| | ||||||||| ||||||||| ||||||||||||| |||||| |||  || |    
14927238 gaaacctgatagcaggtgtcccaacggatcatgaaggaggctctgatgttatcttagaaatcgtggttgagcctaacacaaccacacaaagctgacttat 14927139  T
710 gagatgaggattgtccctcacttataaaca 739  Q
    ||| ||||||||| ||| ||||||||||||    
14927138 gaggtgaggattg-cccccacttataaaca 14927110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #43
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 439 - 516
Target Start/End: Original strand, 28407792 - 28407869
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| |||| ||||| | ||||||||| |||||||||||| ||||||| || ||||||||||||||||||||||    
28407792 tcttagaaatcgtggttgggcctaacacaactccacaaaaccggcttgtgaggtgaggattgcccccacttataaaca 28407869  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #44
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 562 - 627
Target Start/End: Original strand, 31001883 - 31001948
Alignment:
562 cactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggt 627  Q
    ||||||||| ||||||||||||| ||||||||| ||||||  ||||||||||||||||||||||||    
31001883 cactattgggcttggttcgtggatataaatggtaggtggcatgatagcggaaacctgatagcaggt 31001948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #45
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 448 - 516
Target Start/End: Complemental strand, 2324316 - 2324248
Alignment:
448 tcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||| ||||| | |||||||||||||||||||||| ||||||| || ||||||||||||||||||||||    
2324316 tcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaaca 2324248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #46
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 539 - 627
Target Start/End: Original strand, 21383402 - 21383490
Alignment:
539 ttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggt 627  Q
    |||| ||||| ||||||| ||| ||||||||  |||||| |||||| ||||||  |||||||||| |||||||||||||||||||||||    
21383402 ttaacacaccccctcacacccaccactattgtgcttggtgcgtggatataaataatgggtggcccaatagcggaaacctgatagcaggt 21383490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #47
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 461 - 516
Target Start/End: Complemental strand, 2324537 - 2324482
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||||||||||||||||| ||||||| || ||||||||||||||||||||||    
2324537 taacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaaca 2324482  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #48
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 586 - 689
Target Start/End: Original strand, 2375087 - 2375190
Alignment:
586 ataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaa 685  Q
    ||||||||||||||| |||||| || ||| ||||||||||||  ||||||| ||| |||| |||||| |||||||||||| || || || ||| ||||||    
2375087 ataaatggtgggtggtccgataacgaaaatctgatagcaggtgacccaatgaatcctgaaaagactctgatatcatcttaaaaatcttgattgagcctaa 2375186  T
686 caca 689  Q
    ||||    
2375187 caca 2375190  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #49
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 631 - 722
Target Start/End: Complemental strand, 15464884 - 15464793
Alignment:
631 ccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattg 722  Q
    |||||| || |||||||  ||| |||| ||||| | || ||||||||  ||||||||||||||||||||||||||||||||| |||||||||    
15464884 ccaatgaattttgaagatgctccgataccatctaataagtcgtggttaagcctaacacaaccccacaaaactggtttgtgaggtgaggattg 15464793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #50
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 441 - 516
Target Start/End: Original strand, 19191611 - 19191686
Alignment:
441 ttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||| |||| ||||| | |||||||||||||||||||||| ||||||| || |||||| |||||||||||||||    
19191611 ttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgtccccacttataaaca 19191686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #51
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 663 - 737
Target Start/End: Complemental strand, 8424971 - 8424898
Alignment:
663 ttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaa 737  Q
    |||||| ||||||||| || |||||||||||||||||||||||||||||| ||| ||||| ||| ||||||||||    
8424971 ttagaaatcgtggttgagcttaacacaaccccacaaaactggtttgtgaggtgatgattg-cccccacttataaa 8424898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #52
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 663 - 737
Target Start/End: Complemental strand, 13486417 - 13486343
Alignment:
663 ttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaa 737  Q
    |||||| |||||||| ||||||||||||||||||||||   ||||||||| ||||||||| ||| ||||||||||    
13486417 ttagaaatcgtggttaggcctaacacaaccccacaaaatcagtttgtgaggtgaggattgccccccacttataaa 13486343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #53
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 673 - 739
Target Start/End: Original strand, 40718218 - 40718283
Alignment:
673 tggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    ||||||||||||||||||| ||||||||| |||||||||| ||| ||||| ||||||||||||||||    
40718218 tggttgggcctaacacaactccacaaaaccggtttgtgaggtgatgattg-ccctcacttataaaca 40718283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #54
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 670 - 739
Target Start/End: Complemental strand, 2324550 - 2324482
Alignment:
670 tcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    ||||||||| |||||||||||||||||||||| || ||||||| ||||||||| ||| ||||||||||||    
2324550 tcgtggttgagcctaacacaaccccacaaaaccggcttgtgaggtgaggattg-cccccacttataaaca 2324482  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #55
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 441 - 514
Target Start/End: Complemental strand, 8424971 - 8424898
Alignment:
441 ttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaa 514  Q
    |||||| |||| ||||  ||||||||||||||||||||| |||||||||| ||  |||||||||||||||||||    
8424971 ttagaaatcgtggttgagcttaacacaaccccacaaaactggtttgtgaggtgatgattgcccccacttataaa 8424898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #56
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 642 - 739
Target Start/End: Complemental strand, 21591886 - 21591789
Alignment:
642 tgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    ||||||||||| | || || ||||||| |||||||||||||||||||||||||| ||||| |  || |||| ||| ||||| ||| ||||||||||||    
21591886 tgaagagactctgctaccaacttagaaatcgtggttgggcctaacacaaccccataaaaccgacttatgaggtgaagattgccccccacttataaaca 21591789  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #57
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 439 - 516
Target Start/End: Original strand, 25082536 - 25082613
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| |||| ||||||| ||||||||||||||||||| || ||||||| ||  ||||||||| |||||||||||    
25082536 tcttagaaatcgtggttggacctaacacaaccccacaaaactggcttgtgaggtgatgattgcccctacttataaaca 25082613  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #58
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 670 - 739
Target Start/End: Complemental strand, 32884183 - 32884115
Alignment:
670 tcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||| ||||||||||||||||||||||||||| || ||||||| ||||||||| ||| ||||||||||||    
32884183 tcgtagttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattg-cccccacttataaaca 32884115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #59
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 551 - 727
Target Start/End: Complemental strand, 42895443 - 42895266
Alignment:
551 ctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagccc-aatggatcttgaagaga 649  Q
    ||||| |||| ||||||| |  |||||||  ||| ||||||||||||| |||||||||||||||| ||||| ||||| |||| ||||||||||  ||||     
42895443 ctcacgaccaacactattaggtttggttcagggacataaatggtgggtcgcccgatagcggaaacttgatatcaggtggccctaatggatcttagagagg 42895344  T
650 ctcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccct 727  Q
    ||| |||| |||| ||||| ||||  ||  ||| |||| ||||||| ||||  |  ||||||| ||||||||| ||||    
42895343 ctctgataccatcatagaaatcgtaattatgccaaacataaccccataaaatcgacttgtgaggtgaggattgcccct 42895266  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #60
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 448 - 516
Target Start/End: Complemental strand, 5509389 - 5509321
Alignment:
448 tcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||| ||||||| |||||| ||||||||||||||| ||||| | || ||||||||||||||||||||||    
5509389 tcgtggttggacctaacactaccccacaaaaccggcttgtggggtgaggattgcccccacttataaaca 5509321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #61
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 661 - 736
Target Start/End: Complemental strand, 15988498 - 15988423
Alignment:
661 tcttagaactcgtggttgggcctaacacaa-ccccacaaaactggtttgtgagatgaggattgtccctcacttataa 736  Q
    |||||||| ||||||||||||| ||||||| |||||||||||||| ||||||| ||||||||| ||| |||||||||    
15988498 tcttagaaatcgtggttgggcccaacacaacccccacaaaactggcttgtgaggtgaggattg-cccccacttataa 15988423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #62
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 663 - 739
Target Start/End: Original strand, 17854693 - 17854768
Alignment:
663 ttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||| ||||||||||||||||||||| |||||||||| |  ||||||||||| ||||| ||| ||||||||||||    
17854693 ttagaaatcgtggttgggcctaacacaatcccacaaaaccgacttgtgagatgatgattg-cccccacttataaaca 17854768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #63
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 440 - 516
Target Start/End: Complemental strand, 29718412 - 29718336
Alignment:
440 cttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    ||||||| |||| ||| | | |||||||||||||||||||||| ||||||| || ||||||||| ||||||||||||    
29718412 cttagaaatcgtggttaggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgccctcacttataaaca 29718336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #64
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 586 - 666
Target Start/End: Original strand, 36316209 - 36316289
Alignment:
586 ataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttag 666  Q
    |||||||||||||||||||||| ||||||||||||| ||||| |||||| | ||| ||||||| ||| |||| ||| ||||    
36316209 ataaatggtgggtggcccgataacggaaacctgataacaggtggcccaaagaatcgtgaagaggctctgataccatattag 36316289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #65
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 663 - 739
Target Start/End: Original strand, 40149004 - 40149079
Alignment:
663 ttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||| || ||||||| ||||||||||||||||||||  || ||||||| ||||||||||||| ||||||||||||    
40149004 ttagaaatcatggttggacctaacacaaccccacaaaatcggcttgtgaggtgaggattgtccc-cacttataaaca 40149079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #66
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 441 - 516
Target Start/End: Original strand, 17854693 - 17854768
Alignment:
441 ttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||| |||| ||||| | |||||||| ||||||||||||  ||||||||||  |||||||||||||||||||||    
17854693 ttagaaatcgtggttgggcctaacacaatcccacaaaaccgacttgtgagatgatgattgcccccacttataaaca 17854768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #67
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 580 - 726
Target Start/End: Complemental strand, 38630008 - 38629861
Alignment:
580 gtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaag-agactcagatatcatcttagaactcgtggttg 678  Q
    ||||| |||||||| |||||  |||||||||||||||| |||| ||||  ||||  |||||||| || || ||| |||| ||||||| || ||||| |||    
38630008 gtggatataaatggcgggtgatccgatagcggaaacctaatagaaggtgacccatcggatcttggaggaggctctgataccatcttaaaaatcgtgattg 38629909  T
679 ggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccc 726  Q
      | ||||||||  ||||||||| |  |||||||||||||||||||||    
38629908 aacataacacaattccacaaaaccgacttgtgagatgaggattgtccc 38629861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #68
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 462 - 516
Target Start/End: Complemental strand, 17719462 - 17719408
Alignment:
462 aacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||||| |||||||||| ||||||| || ||||||||||||||||||||||    
17719462 aacacaacccgacaaaaccggcttgtgaggtgaggattgcccccacttataaaca 17719408  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #69
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 439 - 516
Target Start/End: Complemental strand, 9927996 - 9927919
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| |||| ||||||| ||||||||||||| |||| | | ||||||| || ||||| ||||||||||||||||    
9927996 tcttagaattcgtggttggacgtaacacaaccccaaaaaatcagcttgtgaggtgaggattacccccacttataaaca 9927919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #70
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 649 - 722
Target Start/End: Complemental strand, 10571067 - 10570994
Alignment:
649 actcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattg 722  Q
    |||| |||| |||||||||| ||||||||| |||||||||||||||||||||| || |||| || ||| |||||    
10571067 actctgataccatcttagaaatcgtggttgagcctaacacaaccccacaaaaccggcttgtaaggtgaagattg 10570994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #71
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 439 - 516
Target Start/End: Original strand, 14466409 - 14466486
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| | || ||||| | |||||||||||||||||||||| |||| || || ||||||| ||||||||||||||    
14466409 tcttagaaatggtggttgggcctaacacaaccccacaaaaccggcttgtaaggtgaggattgctcccacttataaaca 14466486  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #72
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 461 - 510
Target Start/End: Complemental strand, 15464832 - 15464783
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccactta 510  Q
    ||||||||||||||||||| |||||||||| || ||||||||||||||||    
15464832 taacacaaccccacaaaactggtttgtgaggtgaggattgcccccactta 15464783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #73
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 463 - 516
Target Start/End: Original strand, 17525361 - 17525414
Alignment:
463 acacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||| ||||||||||||| ||||||| || ||||||||||||||||||||||    
17525361 acacaatcccacaaaaccggcttgtgaggtgaggattgcccccacttataaaca 17525414  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #74
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 439 - 515
Target Start/End: Original strand, 9952083 - 9952158
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaac 515  Q
    ||||| ||||||| ||||||| |||| ||| ||||||||||||| |||||||||  |||||| ||||||||||||||    
9952083 tcttacaactcgtggttggacctaacgcaatcccacaaaaccggattgtgagataaggattg-ccccacttataaac 9952158  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #75
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 464 - 516
Target Start/End: Original strand, 17854953 - 17855005
Alignment:
464 cacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    ||||||||||||||||||| ||||||| || ||||||||| ||||||||||||    
17854953 cacaaccccacaaaaccggcttgtgaggtgaggattgccctcacttataaaca 17855005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #76
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 662 - 735
Target Start/End: Original strand, 21383284 - 21383359
Alignment:
662 cttagaactcgtggttgggcctaacacaaccccac--aaaactggtttgtgagatgaggattgtccctcacttata 735  Q
    ||||||| | |||||||||||||||||||||||||  ||||| || ||||||| ||||||||| ||| ||||||||    
21383284 cttagaaattgtggttgggcctaacacaaccccacaaaaaaccggcttgtgaggtgaggattgccccccacttata 21383359  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #77
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 440 - 516
Target Start/End: Complemental strand, 32356469 - 32356394
Alignment:
440 cttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    ||||||| |||||||||| | ||||||||| ||||||||| || ||||| | || ||||||||||||||||||||||    
32356469 cttagaattcgtagttgggcctaacacaactccacaaaactggcttgtggg-tgaggattgcccccacttataaaca 32356394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #78
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 663 - 739
Target Start/End: Original strand, 36316052 - 36316127
Alignment:
663 ttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||| |||||||||| ||||||| |||||||||||||||| |||| |  ||||||||| ||| ||||||||||||    
36316052 ttagaaatcgtggttggacctaacataaccccacaaaactggcttgtaatgtgaggattg-cccccacttataaaca 36316127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #79
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 461 - 516
Target Start/End: Complemental strand, 5509142 - 5509087
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||||||||||||||| | ||||||| || ||||| ||||||||||||||||    
5509142 taacacaaccccacaaaaccagcttgtgaggtgaggattacccccacttataaaca 5509087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #80
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 461 - 516
Target Start/End: Complemental strand, 16533610 - 16533555
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||||| ||||||||||| ||||||  || ||||||||||||||||||||||    
16533610 taacacaacctcacaaaaccggcttgtgaagtgaggattgcccccacttataaaca 16533555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #81
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 661 - 712
Target Start/End: Original strand, 31700744 - 31700795
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgag 712  Q
    |||||||| ||||||||||||||||||||| |||||||||| || |||||||    
31700744 tcttagaaatcgtggttgggcctaacacaaacccacaaaaccggcttgtgag 31700795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #82
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 441 - 516
Target Start/End: Original strand, 36316052 - 36316127
Alignment:
441 ttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||| |||| ||||||| ||||| ||||||||||||| || |||| |  || ||||||||||||||||||||||    
36316052 ttagaaatcgtggttggacctaacataaccccacaaaactggcttgtaatgtgaggattgcccccacttataaaca 36316127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #83
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 661 - 739
Target Start/End: Original strand, 36351924 - 36352002
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccac-aaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||| |||||||||||||||||| |||||||| |||| | | ||||||| |||| |||||||| ||||||||||||    
36351924 tcttagaaatcgtggttgggcctaacataaccccacaaaaatttgcttgtgaggtgagaattgtccc-cacttataaaca 36352002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #84
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 461 - 516
Target Start/End: Original strand, 36352180 - 36352235
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||||||||||||||||| || |||| ||  |||||||||||||||||||||    
36352180 taacacaaccccacaaaaccggcttttgaggtgatgattgcccccacttataaaca 36352235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #85
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 461 - 516
Target Start/End: Original strand, 37769964 - 37770019
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||||||||||||||||| || |||| ||  |||||||||||||||||||||    
37769964 taacacaaccccacaaaaccggcttatgaggtgaagattgcccccacttataaaca 37770019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #86
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 461 - 516
Target Start/End: Original strand, 40718228 - 40718283
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    ||||||||| |||||||||||||||||||| ||  |||||||| ||||||||||||    
40718228 taacacaactccacaaaaccggtttgtgaggtgatgattgccctcacttataaaca 40718283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #87
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 453 - 514
Target Start/End: Original strand, 5851694 - 5851756
Alignment:
453 gttggacttaacacaacc-ccacaaaaccggtttgtgagatgtggattgcccccacttataaa 514  Q
    ||||||| |||||||||| |||||||||||| ||||||| || |||||| |||||||||||||    
5851694 gttggacctaacacaacctccacaaaaccggcttgtgaggtgaggattgtccccacttataaa 5851756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #88
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 661 - 738
Target Start/End: Original strand, 9952083 - 9952158
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaac 738  Q
    ||||| ||||||||||||| |||||| ||| |||||||||| || ||||||||| |||||||  || |||||||||||    
9952083 tcttacaactcgtggttggacctaacgcaatcccacaaaaccggattgtgagataaggattg--ccccacttataaac 9952158  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #89
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 462 - 516
Target Start/End: Complemental strand, 37840399 - 37840345
Alignment:
462 aacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    ||||||||||||||||||||| ||||||| ||  ||||||| |||||||||||||    
37840399 aacacaaccccacaaaaccggcttgtgaggtgatgattgcctccacttataaaca 37840345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #90
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 670 - 739
Target Start/End: Complemental strand, 5509389 - 5509321
Alignment:
670 tcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||||| |||||||| |||||||||||| || ||||| | ||||||||| ||| ||||||||||||    
5509389 tcgtggttggacctaacactaccccacaaaaccggcttgtggggtgaggattg-cccccacttataaaca 5509321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #91
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 673 - 737
Target Start/End: Original strand, 5851692 - 5851756
Alignment:
673 tggttgggcctaacacaacc-ccacaaaactggtttgtgagatgaggattgtccctcacttataaa 737  Q
    ||||||| |||||||||||| ||||||||| || ||||||| ||||||||||||| ||||||||||    
5851692 tggttggacctaacacaacctccacaaaaccggcttgtgaggtgaggattgtccc-cacttataaa 5851756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #92
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 439 - 516
Target Start/End: Original strand, 19544370 - 19544446
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| |||| ||||||| ||||| | | |||||||||||| ||||||| ||  |||||||||||||||||||||    
19544370 tcttagaaatcgtggttggacctaacatagctccacaaaaccggcttgtgaggtg-agattgcccccacttataaaca 19544446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #93
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 471 - 516
Target Start/End: Original strand, 33606085 - 33606130
Alignment:
471 ccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||||||||||||||| || |||||||||| |||||||||||    
33606085 ccacaaaaccggtttgtgaggtgaggattgcccctacttataaaca 33606130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #94
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 670 - 739
Target Start/End: Original strand, 37769951 - 37770019
Alignment:
670 tcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    ||||||||||| |||||||||||||||||||| || || |||| ||| ||||| ||| ||||||||||||    
37769951 tcgtggttgggtctaacacaaccccacaaaaccggcttatgaggtgaagattg-cccccacttataaaca 37770019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #95
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 608 - 701
Target Start/End: Complemental strand, 5594166 - 5594072
Alignment:
608 gcggaaacctgatagcaggtag--cccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaac 701  Q
    ||||||||||||||||||||    ||||||||||||||||||| ||| ||||  |||||| || ||||| ||| ||||||||||| ||| ||||||    
5594166 gcggaaacctgatagcaggtgtgacccaatggatcttgaagaggctctgatactatctta-aaatcgtgattgagcctaacacaatcccgcaaaac 5594072  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #96
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 559 - 643
Target Start/End: Complemental strand, 19110430 - 19110346
Alignment:
559 cagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttg 643  Q
    |||||||||||  ||||||||||||  ||||||| ||  ||||||||||||  |||||| |||||||||  ||||| ||||||||    
19110430 cagcactattgagcttggttcgtgggcataaatgatgaatggcccgatagcaaaaacctaatagcaggtgacccaacggatcttg 19110346  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #97
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 629 - 685
Target Start/End: Original strand, 31700939 - 31700995
Alignment:
629 gcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaa 685  Q
    ||||||||||||||| |||| |||  ||| |||||||||| ||||||||||||||||    
31700939 gcccaatggatcttggagaggctctaataccatcttagaaatcgtggttgggcctaa 31700995  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #98
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 663 - 739
Target Start/End: Original strand, 33606056 - 33606130
Alignment:
663 ttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||| ||||||||||| |||||| ||  ||||||||| |||||||||| ||||||||| |||| |||||||||||    
33606056 ttagaaatcgtggttgggtctaaca-aattccacaaaaccggtttgtgaggtgaggattgcccct-acttataaaca 33606130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #99
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 458 - 514
Target Start/End: Original strand, 35418432 - 35418488
Alignment:
458 acttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaa 514  Q
    ||||||| |||||||| |||||||| ||||||| || ||||||||||||| ||||||    
35418432 acttaacgcaaccccataaaaccggcttgtgaggtgaggattgcccccacctataaa 35418488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #100
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 659 - 739
Target Start/End: Complemental strand, 37840424 - 37840345
Alignment:
659 catcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    ||||||| || | ||||||||||| |||||||||||||||||| || ||||||| ||| ||||| ||  ||||||||||||    
37840424 catcttaaaaattgtggttgggcccaacacaaccccacaaaaccggcttgtgaggtgatgattg-cctccacttataaaca 37840345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #101
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 586 - 625
Target Start/End: Original strand, 11099526 - 11099565
Alignment:
586 ataaatggtgggtggcccgatagcggaaacctgatagcag 625  Q
    |||||||||||||||| |||||||||||| ||||||||||    
11099526 ataaatggtgggtggctcgatagcggaaatctgatagcag 11099565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #102
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 661 - 740
Target Start/End: Original strand, 15124547 - 15124625
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaacat 740  Q
    ||||| || ||||||||||| |||||||||||||||||||  || || |||| || |||||| ||| |||||||||||||    
15124547 tcttaaaaatcgtggttgggtctaacacaaccccacaaaatcggcttatgaggtggggattg-cccccacttataaacat 15124625  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #103
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 439 - 513
Target Start/End: Complemental strand, 15988498 - 15988423
Alignment:
439 tcttagaactcgtagttggacttaacacaacccc-acaaaaccggtttgtgagatgtggattgcccccacttataa 513  Q
    |||||||| |||| ||||| |  ||||||||||| ||||||| || ||||||| || |||||||||||||||||||    
15988498 tcttagaaatcgtggttgggcccaacacaacccccacaaaactggcttgtgaggtgaggattgcccccacttataa 15988423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #104
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 597 - 668
Target Start/End: Complemental strand, 33455951 - 33455881
Alignment:
597 gtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaa 668  Q
    |||||| ||||||| ||||||||| |||||||||||||| ||||||  | |||||| |||| ||||||||||    
33455951 gtggcctgatagcgaaaacctgatggcaggtagcccaat-gatcttcgatagactctgataccatcttagaa 33455881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #105
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 672 - 739
Target Start/End: Original strand, 42639624 - 42639690
Alignment:
672 gtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    ||||||||| ||||||||||||||||||||  | ||||||| ||| ||||||||| || |||||||||    
42639624 gtggttgggtctaacacaaccccacaaaaccagcttgtgaggtgacgattgtccc-catttataaaca 42639690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #106
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 579 - 630
Target Start/End: Complemental strand, 42895644 - 42895593
Alignment:
579 cgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagc 630  Q
    |||||| ||||||||||||||   | ||||||||||||||||||||||||||    
42895644 cgtggatataaatggtgggtgagtctatagcggaaacctgatagcaggtagc 42895593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #107
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 454 - 516
Target Start/End: Complemental strand, 11020628 - 11020566
Alignment:
454 ttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||| |||||||| ||||| ||| ||| ||||||| || |||||||| |||||||||||||    
11020628 ttggacctaacacaatcccactaaatcggcttgtgaggtgaggattgcctccacttataaaca 11020566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #108
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 461 - 514
Target Start/End: Complemental strand, 13486397 - 13486343
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgc-ccccacttataaa 514  Q
    |||||||||||||||||| | ||||||||| || ||||||| |||||||||||||    
13486397 taacacaaccccacaaaatcagtttgtgaggtgaggattgccccccacttataaa 13486343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #109
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 572 - 722
Target Start/End: Complemental strand, 15461148 - 15460998
Alignment:
572 cttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactc 671  Q
    ||||||||||||| ||||||| || ||| |||||||||| ||| |||||||||| |   | ||| || |||| ||||  || || |  |||||| || |     
15461148 cttggttcgtggacataaatgatgtgtgacccgatagcgaaaatctgatagcagttgatctaattgaccttggagaggttctgaaactatcttaaaaatt 15461049  T
672 gtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattg 722  Q
     |||||| | ||||||||||||||||||||||  ||||||| ||| |||||    
15461048 atggttgagtctaacacaaccccacaaaactgtcttgtgaggtgatgattg 15460998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #110
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 661 - 739
Target Start/End: Original strand, 19570973 - 19571050
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||| |||||||||||||||||||||  ||||||||  |  || |||| ||||||||| ||| ||||||||||||    
19570973 tcttagaaatcgtggttgggcctaacacaattccacaaaatcgacttatgaggtgaggattg-cccccacttataaaca 19571050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #111
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 661 - 739
Target Start/End: Original strand, 30006578 - 30006655
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||| |||||||||||||  |||||||| |||||||| || ||||| | ||| |||| |||| ||||||||||||    
30006578 tcttagaaatcgtggttgggccgtacacaacctcacaaaaccggcttgtgtggtgatgattatccc-cacttataaaca 30006655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #112
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 661 - 739
Target Start/End: Original strand, 30063266 - 30063343
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||| |||||||||||||  |||||||| |||||||| || ||||| | ||| |||| |||| ||||||||||||    
30063266 tcttagaaatcgtggttgggccatacacaacctcacaaaaccggcttgtgtggtgatgattatccc-cacttataaaca 30063343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #113
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 654 - 736
Target Start/End: Original strand, 31008563 - 31008644
Alignment:
654 gatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataa 736  Q
    |||||||| ||||||   ||||||| |||||||||||||||||||||| ||  |||||| |||| |||| ||| |||||||||    
31008563 gatatcattttagaaactgtggttgagcctaacacaaccccacaaaaccggcatgtgaggtgagaattg-cccacacttataa 31008644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #114
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 686 - 724
Target Start/End: Complemental strand, 43319748 - 43319710
Alignment:
686 cacaaccccacaaaactggtttgtgagatgaggattgtc 724  Q
    ||||||||||||||||||||||||||| |||| ||||||    
43319748 cacaaccccacaaaactggtttgtgaggtgagaattgtc 43319710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #115
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 472 - 513
Target Start/End: Original strand, 93479 - 93520
Alignment:
472 cacaaaaccggtttgtgagatgtggattgcccccacttataa 513  Q
    ||||||||||| ||||||| || |||||||||||||||||||    
93479 cacaaaaccggcttgtgaggtgaggattgcccccacttataa 93520  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #116
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 472 - 513
Target Start/End: Original strand, 93752 - 93793
Alignment:
472 cacaaaaccggtttgtgagatgtggattgcccccacttataa 513  Q
    ||||||||||| ||||||| || |||||||||||||||||||    
93752 cacaaaaccggcttgtgaggtgaggattgcccccacttataa 93793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #117
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 461 - 514
Target Start/End: Original strand, 1926462 - 1926515
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaa 514  Q
    |||||||| || ||||||||| |||||||| || ||||| ||||||||||||||    
1926462 taacacaatcctacaaaaccgatttgtgaggtgaggattacccccacttataaa 1926515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #118
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 475 - 516
Target Start/End: Complemental strand, 3738982 - 3738941
Alignment:
475 aaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||||||||||  || ||||||||||||||||||||||    
3738982 aaaaccggtttgtgatgtgaggattgcccccacttataaaca 3738941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #119
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 671 - 736
Target Start/End: Original strand, 12343759 - 12343823
Alignment:
671 cgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataa 736  Q
    |||||||||| ||||||||||||||||||||||  || |||  ||||||||| ||| |||||||||    
12343759 cgtggttgggtctaacacaaccccacaaaactgacttatgatgtgaggattg-cccccacttataa 12343823  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #120
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 453 - 522
Target Start/End: Original strand, 13296367 - 13296436
Alignment:
453 gttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaacatcttat 522  Q
    ||||||| |||||||||| ||| | || | |||||||| || ||||| ||||||||||||||||| ||||    
13296367 gttggacctaacacaacctcactacactgatttgtgaggtgaggattacccccacttataaacatattat 13296436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #121
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 439 - 516
Target Start/End: Original strand, 15124782 - 15124859
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| |||| |||||   |||||||||||||||||||||  ||||||  ||  |||||||| ||||||||||||    
15124782 tcttagaaatcgtggttgggtctaacacaaccccacaaaaccgaattgtgaagtgaagattgccctcacttataaaca 15124859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #122
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 439 - 516
Target Start/End: Original strand, 19570973 - 19571050
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| |||| ||||| | ||||||||  |||||||| ||  || |||| || ||||||||||||||||||||||    
19570973 tcttagaaatcgtggttgggcctaacacaattccacaaaatcgacttatgaggtgaggattgcccccacttataaaca 19571050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #123
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 439 - 504
Target Start/End: Complemental strand, 24395948 - 24395883
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccc 504  Q
    |||||||| |||| ||| | | |||||||||||||||||| || |||||||| || ||||||||||    
24395948 tcttagaaatcgtggtttggcctaacacaaccccacaaaatcgatttgtgaggtgaggattgcccc 24395883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #124
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 439 - 516
Target Start/End: Original strand, 27897605 - 27897681
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| | || ||||| | |||||||||||||||||||||  ||||||| || | |||| |||||||||||||||    
27897605 tcttagaaatggtggttgggcctaacacaaccccacaaaaccgacttgtgaggtgagaattg-ccccacttataaaca 27897681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #125
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 441 - 514
Target Start/End: Complemental strand, 31222604 - 31222531
Alignment:
441 ttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaa 514  Q
    |||||| |||| ||||| | ||||||||||| |||||| |||||| || | || |||||||| |||||||||||    
31222604 ttagaaatcgtggttggtcctaacacaaccctacaaaatcggtttatggggtgaggattgcctccacttataaa 31222531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #126
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 439 - 516
Target Start/End: Original strand, 31700744 - 31700824
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagat-gtgg--attgcccccacttataaaca 516  Q
    |||||||| |||| ||||| | |||||||| ||||||||||||| ||||||| | ||||  ||||||| ||||||||||||    
31700744 tcttagaaatcgtggttgggcctaacacaaacccacaaaaccggcttgtgaggtggtgggaattgccctcacttataaaca 31700824  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #127
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 439 - 516
Target Start/End: Original strand, 33606288 - 33606365
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| |||| ||||  | ||||| ||| ||||||||| || ||||||| || ||||| ||||||||||||||||    
33606288 tcttagaaatcgtggttgtgcctaacataacgccacaaaactggcttgtgaggtgaggattacccccacttataaaca 33606365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 135; Significance: 6e-70; HSPs: 131)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 135; E-Value: 6e-70
Query Start/End: Original strand, 439 - 739
Target Start/End: Original strand, 41666756 - 41667069
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaacatcttata-------------tt 525  Q
    |||||||| |||| ||||| | |||||||||||||||||||||| ||||||| || ||||||||||||||||||||||  || |              |     
41666756 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcaggccatgtcctgtc 41666855  T
526 cgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcag 625  Q
    ||||||||||| ||||| ||||| |||||| |||||||||||||| ||||||||||||| |||||||||||||||||||||| |||||||||||||||||    
41666856 cgatgtgggactcttaacacaccccctcacgaccagcactattgggcttggttcgtggacataaatggtgggtggcccgataacggaaacctgatagcag 41666955  T
626 gtagcccaatggatctt-gaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtc 724  Q
    || |||||| ||||||| || ||| ||| |||| |||||||||| |||||||||||||||||||||||||||||||| || ||||||| ||||||||| |    
41666956 gtggcccaacggatcttggaggaggctctgataccatcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattg-c 41667054  T
725 cctcacttataaaca 739  Q
    || ||||||||||||    
41667055 ccccacttataaaca 41667069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 130; E-Value: 6e-67
Query Start/End: Original strand, 439 - 739
Target Start/End: Original strand, 18333464 - 18333776
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca-------------tcttatatt 525  Q
    |||||||| | || ||||| | |||||||||||||||||||||| ||||||| || ||||| ||||||||||||||||             |||  |||     
18333464 tcttagaatttgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattacccccacttataaacacattgtcagaccatctcctatc 18333563  T
526 cgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcag 625  Q
    ||||||||||  ||||| ||||| |||||| |||||||||| ||| ||||||||||||| ||||||||||||||||||||||||| ||||||||||||||    
18333564 cgatgtgggattcttaacacacc-cctcacgaccagcactaatgggcttggttcgtggacataaatggtgggtggcccgatagcgaaaacctgatagcag 18333662  T
626 gtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtcc 725  Q
    || |||| ||||||||||||||| ||| |||| |||||||||| |||||||||||||||||||||||||||||||| || ||||||| ||| ||||  ||    
18333663 gtggcccgatggatcttgaagaggctctgataccatcttagaattcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgacgattaccc 18333762  T
726 ctcacttataaaca 739  Q
    | ||||||||||||    
18333763 cccacttataaaca 18333776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 121; E-Value: 1e-61
Query Start/End: Original strand, 439 - 739
Target Start/End: Complemental strand, 15480644 - 15480330
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattg--cccccacttataaa-------------catcttata 523  Q
    |||||||| | || ||||| | |||||||||||||||||||||| ||||||| || ||||||  ||||||||||||||             ||| | |||    
15480644 tcttagaaattgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgatcccccacttataaacacgttgtcaggccatgtcata 15480545  T
524 ttcgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagc 623  Q
    |  |||||||||| ||||| ||||| |||||| |||||||| ||| | |||||||| |||| |||||||||||||||||| |||||||||||||||||||    
15480544 tctgatgtgggactcttaacacacctcctcacgaccagcacgattaggcttggttcatggacataaatggtgggtggcccaatagcggaaacctgatagc 15480445  T
624 aggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgt 723  Q
    |||| |||||||||||||||||||| ||| |||| |||||||||| |||||||||||||||||| |||||||||||||  | ||||||| |||||||||     
15480444 aggtggcccaatggatcttgaagaggctctgataccatcttagaaatcgtggttgggcctaacagaaccccacaaaaccagcttgtgaggtgaggattg- 15480346  T
724 ccctcacttataaaca 739  Q
    ||| ||||||||||||    
15480345 cccccacttataaaca 15480330  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 114; E-Value: 2e-57
Query Start/End: Original strand, 439 - 687
Target Start/End: Original strand, 95265 - 95526
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaacatcttat-------------att 525  Q
    |||||||| || | ||||| | |||||||||||||||||||||| |||||||||| |||||| |||||||||||||||  || |             ||     
95265 tcttagaattcttggttgggcctaacacaaccccacaaaaccggcttgtgagatgaggattgtccccacttataaacacattgtcaggtcatcacctatc 95364  T
526 cgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcag 625  Q
    ||||||| ||| ||||| ||||| |||||| |||||||||||||| ||||||||||||| ||||||||||||||||||||| ||||||||||||||||||    
95365 cgatgtgtgactcttaacacaccccctcacgaccagcactattgggcttggttcgtggacataaatggtgggtggcccgatggcggaaacctgatagcag 95464  T
626 gtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaaca 687  Q
    || ||||||||||||||| |||| ||| |||| |||||||||| ||||||||||||||||||    
95465 gtggcccaatggatcttggagaggctctgataccatcttagaaatcgtggttgggcctaaca 95526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 114; E-Value: 2e-57
Query Start/End: Original strand, 526 - 739
Target Start/End: Complemental strand, 9368815 - 9368603
Alignment:
526 cgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcag 625  Q
    ||||||||||| ||||| ||||| |||||| ||||||||||||||  |||||||||||| ||| ||||||||||| || |||||||||||||||||||||    
9368815 cgatgtgggactcttaagacaccccctcacgaccagcactattgggtttggttcgtggacatacatggtgggtggtccaatagcggaaacctgatagcag 9368716  T
626 gtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtcc 725  Q
    || |||||||||||||||||||| ||| |||| || ||||||| |  ||||||||||||||||||||||||||||| || ||||||| ||||||||| ||    
9368715 gtggcccaatggatcttgaagaggctctgataccaccttagaaattatggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattg-cc 9368617  T
726 ctcacttataaaca 739  Q
      ||||||||||||    
9368616 tccacttataaaca 9368603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 109; E-Value: 2e-54
Query Start/End: Original strand, 526 - 717
Target Start/End: Original strand, 24346600 - 24346792
Alignment:
526 cgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcag 625  Q
    ||||||||||| ||||| ||||| |||||| |||||||||||||  ||||||||||||| |||||||||||||||||||||| |||||||||||||||||    
24346600 cgatgtgggactcttaacacaccccctcacgaccagcactattgagcttggttcgtggacataaatggtgggtggcccgataacggaaacctgatagcag 24346699  T
626 gtagcccaatggatctt-gaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgag 717  Q
    || |||||||||||||| || ||| ||| |||| ||||||| || ||||||||||| |||||||||||||||||||| || ||||||| ||||    
24346700 gtggcccaatggatcttggaggaggctctgataccatcttaaaaatcgtggttgggtctaacacaaccccacaaaaccggcttgtgaggtgag 24346792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 103; E-Value: 8e-51
Query Start/End: Original strand, 461 - 737
Target Start/End: Original strand, 26137130 - 26137419
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaacatcttat-------------attcgatgtgggacgcttaatacac 547  Q
    ||||| ||||||||||||||||||||||||||| |||||||||||| |||||||||| || |             |||||||||||||| ||||||||||    
26137130 taacataaccccacaaaaccggtttgtgagatgaggattgcccccatttataaacatgttgtcatatcatttcctattcgatgtgggactcttaatacac 26137229  T
548 cacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaag- 646  Q
    | |||||| || |||| |||||||||||||||||||| ||||||| ||||||||||||| | | |||||||||||||||| ||||||   |||||| ||     
26137230 cccctcacgactagcattattggacttggttcgtggacataaatgatgggtggcccgatggtgaaaacctgatagcaggtggcccaacaaatcttggagt 26137329  T
647 agactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaa 737  Q
    || ||| |||| || ||||||| |||||||||||||||||| || ||||||||||    ||||||||||||||||||| | ||||||||||    
26137330 aggctctgataccaccttagaaatcgtggttgggcctaacataatcccacaaaaccaacttgtgagatgaggattgtcgc-cacttataaa 26137419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 101; E-Value: 1e-49
Query Start/End: Original strand, 526 - 717
Target Start/End: Original strand, 24269969 - 24270160
Alignment:
526 cgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcag 625  Q
    ||||||||||| ||||| ||||| |||||| |||||||||||||  ||||||||||||| |||||||||||||||||||||| |||||||||||||||||    
24269969 cgatgtgggactcttaacacaccccctcacgaccagcactattgagcttggttcgtggacataaatggtgggtggcccgataacggaaacctgatagcag 24270068  T
626 gtagcccaatggatctt-gaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgag 717  Q
    || |||||||||||||| || ||| ||| |||| ||||||| || |||||||| || |||||||||||||||||||| || ||||||| ||||    
24270069 gtggcccaatggatcttggaggaggctctgataccatcttaaaaatcgtggtt-ggtctaacacaaccccacaaaaccggcttgtgaggtgag 24270160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 100; E-Value: 5e-49
Query Start/End: Original strand, 439 - 740
Target Start/End: Original strand, 25258093 - 25258378
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaacatcttatattcgatgtgggacgc 538  Q
    |||||||| |||| ||||| | |||||||||||||||||||||| ||||||| || |||||||||||||||                |||||||| || |    
25258093 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttc---------------cgatgtggaactc 25258177  T
539 ttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatgga 638  Q
    |||| ||||| |||||  ||||||| |||| | ||||||||||||| |||||| |||||||| |||||||||||||||||||||||||| ||||||||||    
25258178 ttaacacaccccctcatgaccagcattatttggcttggttcgtggacataaattgtgggtggtccgatagcggaaacctgatagcaggtggcccaatgga 25258277  T
639 tcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaac 738  Q
    ||||| |||  ||| |||| |||||||||| ||||||||| |  ||||||||||||||||||| |  ||||||| ||||||||| ||| |||| ||||||    
25258278 tcttggagaagctctgataccatcttagaaatcgtggttgagtttaacacaaccccacaaaaccgacttgtgaggtgaggattg-cccccactgataaac 25258376  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 100; E-Value: 5e-49
Query Start/End: Original strand, 439 - 740
Target Start/End: Original strand, 25321883 - 25322168
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaacatcttatattcgatgtgggacgc 538  Q
    |||||||| |||| ||||| | |||||||||||||||||||||| ||||||| || |||||||||||||||                |||||||| || |    
25321883 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttc---------------cgatgtggaactc 25321967  T
539 ttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatgga 638  Q
    |||| ||||| |||||  ||||||| |||| | ||||||||||||| |||||| |||||||| |||||||||||||||||||||||||| ||||||||||    
25321968 ttaacacaccccctcatgaccagcattatttggcttggttcgtggacataaattgtgggtggtccgatagcggaaacctgatagcaggtggcccaatgga 25322067  T
639 tcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaac 738  Q
    ||||| |||  ||| |||| |||||||||| ||||||||| |  ||||||||||||||||||| |  ||||||| ||||||||| ||| |||| ||||||    
25322068 tcttggagaagctctgataccatcttagaaatcgtggttgagtttaacacaaccccacaaaaccgacttgtgaggtgaggattg-cccccactgataaac 25322166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 95; E-Value: 5e-46
Query Start/End: Original strand, 537 - 739
Target Start/End: Complemental strand, 24531808 - 24531607
Alignment:
537 gcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatg 636  Q
    |||||| ||||| |||||| |||||||||||||| ||||||||||||| ||||||| |||||||  ||||| | |||| |||||||||||| ||||||||    
24531808 gcttaacacaccccctcacgaccagcactattgggcttggttcgtggacataaatgttgggtggttcgataacagaaaactgatagcaggtggcccaatg 24531709  T
637 gatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataa 736  Q
    |||| |  |||| ||| |||| |||||||||| |||||||||||| ||||||||||||||||||  || ||||||| ||||||||| ||| |||||||||    
24531708 gatcatagagaggctctgataccatcttagaaatcgtggttgggcataacacaaccccacaaaatcggcttgtgaggtgaggattg-cccccacttataa 24531610  T
737 aca 739  Q
    |||    
24531609 aca 24531607  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 94; E-Value: 2e-45
Query Start/End: Original strand, 522 - 739
Target Start/End: Original strand, 6919289 - 6919504
Alignment:
522 tattcgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgata 621  Q
    |||| |||||||||| ||||| ||||  | |||| |||||||||||||| ||||||||||||| |||||||||| |||| |||| |||||||||||||||    
6919289 tatttgatgtgggactcttaacacacaccatcacgaccagcactattgggcttggttcgtggacataaatggtgagtggtccgaaagcggaaacctgata 6919388  T
622 gcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggatt 721  Q
    |||| |  | ||||||||||||||||| ||  |||| ||||||| || ||||||||| ||||||||||||| ||||||||| | ||||||| |||| |||    
6919389 gcagatgactcaatggatcttgaagaggctttgataccatcttaaaaatcgtggttgagcctaacacaacctcacaaaact-gcttgtgaggtgagaatt 6919487  T
722 gtccctcacttataaaca 739  Q
    ||||| ||||||||||||    
6919488 gtccc-cacttataaaca 6919504  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 94; E-Value: 2e-45
Query Start/End: Original strand, 437 - 701
Target Start/End: Original strand, 32908715 - 32908991
Alignment:
437 agtcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca-------------tcttata 523  Q
    |||||||||| |||| |||||   ||||| |||||| ||||||||||||||||| ||  ||||||| |||||||||||||             || | ||    
32908715 agtcttagaaatcgtggttgggtctaacataacccctcaaaaccggtttgtgaggtgatgattgcctccacttataaacacattgtcagatcatcctcta 32908814  T
524 ttcgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagc 623  Q
    ||| |||| |||| ||||| ||||| |||||| ||||||||||||||  ||||||||| || |||||||||||||| ||||||||| |||||||||||||    
32908815 ttcaatgtaggactcttaacacacc-cctcacgaccagcactattgggtttggttcgttgacataaatggtgggtgacccgatagcagaaacctgatagc 32908913  T
624 aggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaac 701  Q
    || | |||||||||||||||||||| |||  |||||||||||||| | ||||||| | ||||||||||||||||||||    
32908914 agatggcccaatggatcttgaagaggctctaatatcatcttagaaattgtggttgagtctaacacaaccccacaaaac 32908991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 86; E-Value: 1e-40
Query Start/End: Original strand, 538 - 695
Target Start/End: Original strand, 17150344 - 17150501
Alignment:
538 cttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatgg 637  Q
    ||||| ||||| |||||||| || |||||||||  ||||||  |||| ||||||||||||||||||||||||||||||||||||| |||| |||||||||    
17150344 cttaacacaccccctcacaaacaacactattggtattggtttctggacataaatggtgggtggcccgatagcggaaacctgatagtaggtggcccaatgg 17150443  T
638 atcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaacccca 695  Q
    ||||||||||| ||| |||| ||||||| || |||| |||| ||||||||||||||||    
17150444 atcttgaagaggctctgataccatcttaaaaatcgtagttgagcctaacacaacccca 17150501  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 85; E-Value: 4e-40
Query Start/End: Original strand, 527 - 739
Target Start/End: Complemental strand, 24528759 - 24528548
Alignment:
527 gatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcagg 626  Q
    |||||||||| ||||| ||||| |||||  || ||||||||| | ||||||||||||| ||||||| |||||||  |||||   |||| || ||||||||    
24528759 gatgtgggactcttaacacaccccctcatgacaagcactattaggcttggttcgtggacataaatgttgggtggttcgataatagaaaactaatagcagg 24528660  T
627 tagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccc 726  Q
    | | |||||||||| || |||| ||| |||| |||||||||| || ||||||||||||||||||||||||||||| || ||||||| ||||||||| |||    
24528659 tggtccaatggatcatggagaggctctgataccatcttagaaatcatggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattg-ccc 24528561  T
727 tcacttataaaca 739  Q
     ||||||||||||    
24528560 ccacttataaaca 24528548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 84; E-Value: 2e-39
Query Start/End: Original strand, 572 - 739
Target Start/End: Original strand, 6413567 - 6413733
Alignment:
572 cttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactc 671  Q
    ||||||||||||| |||||||||||||||| |||||| ||| |||||||||||||| |||||||||||||||||||| ||  |||| ||| |||||| ||    
6413567 cttggttcgtggacataaatggtgggtggctcgatagtggatacctgatagcaggtggcccaatggatcttgaagaggctttgataccatattagaaatc 6413666  T
672 gtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    || ||||||  ||||||||||||| ||||| || || |||| |||||||||||||| |||||||||||    
6413667 gttgttgggtttaacacaaccccaaaaaaccggcttatgaggtgaggattgtccct-acttataaaca 6413733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 83; E-Value: 7e-39
Query Start/End: Original strand, 525 - 739
Target Start/End: Original strand, 17352532 - 17352744
Alignment:
525 tcgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagca 624  Q
    |||||||||||| ||||| ||||| ||| || ||||||| |||||| ||||||||||||| ||||| ||| |||| ||| ||||||||||||||||||||    
17352532 tcgatgtgggactcttaacacacctccttacgaccagcattattgggcttggttcgtggacataaacggtaggtgacccaatagcggaaacctgatagca 17352631  T
625 ggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtc 724  Q
     || || ||| ||||||||||||| ||| |||| |||||||||| | |||||||| ||||||| |||||| ||||| ||| ||||||| ||| ||||  |    
17352632 agtggctcaa-ggatcttgaagaggctctgataccatcttagaaatggtggttggacctaacataaccccgcaaaattggcttgtgaggtgaagatt-ac 17352729  T
725 cctcacttataaaca 739  Q
    || ||||||||||||    
17352730 ccccacttataaaca 17352744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 82; E-Value: 3e-38
Query Start/End: Original strand, 550 - 699
Target Start/End: Complemental strand, 43117843 - 43117694
Alignment:
550 cctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagaga 649  Q
    |||||| |||| ||||||||  ||||||||||||| ||||||| ||||||| |||||||||||||||||||||||||| ||||||| ||||||| | ||     
43117843 cctcacgaccaacactattgagcttggttcgtggacataaatgatgggtggtccgatagcggaaacctgatagcaggtggcccaatagatcttggaaagg 43117744  T
650 ctcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaa 699  Q
    ||| ||||  ||||||||| |||| |||||||||||||||||||||||||    
43117743 ctctgatactatcttagaaatcgttgttgggcctaacacaaccccacaaa 43117694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 79; E-Value: 2e-36
Query Start/End: Original strand, 439 - 643
Target Start/End: Original strand, 8081112 - 8081330
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgccccc-acttataaacatcttat-------------at 524  Q
    |||||||| || | ||||| | |||||||||||||||||||||| |||||||||| ||||||||||| |||||||||||  || |             ||    
8081112 tcttagaaatcatggttgggcctaacacaaccccacaaaaccggcttgtgagatgaggattgccccccacttataaacacattgtcaggccatgtcctat 8081211  T
525 tcgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagca 624  Q
     ||||||||||| ||||| ||||| |||||| |||||||||||||| ||||||||||||| ||||||||||||||| ||||||| ||| |||||||||||    
8081212 ccgatgtgggactcttaacacaccccctcacgaccagcactattgggcttggttcgtggacataaatggtgggtggtccgataggggatacctgatagca 8081311  T
625 ggtagcccaatggatcttg 643  Q
    ||| ||||||| |||||||    
8081312 ggtggcccaatcgatcttg 8081330  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 79; E-Value: 2e-36
Query Start/End: Original strand, 526 - 739
Target Start/End: Original strand, 38731702 - 38731914
Alignment:
526 cgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggccc-gatagcggaaacctgatagca 624  Q
    |||||||| || ||||| ||||| |||||| |||||||||||||| |||||||| |||| ||||||| |||||| ||  |||||| ||||||||||||||    
38731702 cgatgtggaacacttaacacacc-cctcacgaccagcactattgggcttggttcatggacataaatgatgggtgcccgtgatagcagaaacctgatagca 38731800  T
625 ggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtc 724  Q
    |||||| ||||| || |||||||| ||  |||| |||||||||| | ||||||| ||||||||||||| |||||||  |  ||||||| ||||||||||     
38731801 ggtagctcaatgaattttgaagaggctatgatagcatcttagaaatggtggttgtgcctaacacaacctcacaaaatcgacttgtgaggtgaggattgt- 38731899  T
725 cctcacttataaaca 739  Q
     ||||||||||||||    
38731900 tctcacttataaaca 38731914  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 74; E-Value: 2e-33
Query Start/End: Original strand, 439 - 722
Target Start/End: Original strand, 33337237 - 33337515
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaacatcttat-------------att 525  Q
    ||||| || |||| ||||||||||||||| |  ||||||| ||||||||||| ||  |||||||||||||||||||||| || |             ||     
33337237 tcttaaaaatcgtggttggacttaacacagcttcacaaaatcggtttgtgaggtgatgattgcccccacttataaacatattgtcaggccatcacctatc 33337336  T
526 cgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcag 625  Q
    | ||||||||| ||||| ||||| |||||  |||||||||||||| ||||||||||||| ||||||||||||||||||||| |||||||||||||||||     
33337337 caatgtgggactcttaacacaccccctcatgaccagcactattgggcttggttcgtggacataaatggtgggtggcccgatggcggaaacctgatagcaa 33337436  T
626 gtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattg 722  Q
     | | ||||||||||                  |||||||||| |||||||||  ||||||||||||||||||||| ||||||||||||||||||||    
33337437 atggtccaatggatc------------------catcttagaaatcgtggttgaacctaacacaaccccacaaaaccggtttgtgagatgaggattg 33337515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 72; E-Value: 3e-32
Query Start/End: Original strand, 435 - 665
Target Start/End: Original strand, 20510637 - 20510879
Alignment:
435 taagtcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaacatcttat------------ 522  Q
    |||||||||||| ||||  |||| | ||||||||| ||||||||| ||||| |||| || ||||||||||||||||||||||| || |                
20510637 taagtcttagaaatcgtgtttgggcctaacacaactccacaaaactggtttttgaggtgaggattgcccccacttataaacatattgtcaggccatcacc 20510736  T
523 -attcgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgata 621  Q
     || ||||||||| | ||||| ||||| |||||| | || ||||||||| ||||||||||||| |||||||| ||||||||| ||||| |||||||||||    
20510737 tatccgatgtggggctcttaacacaccccctcacgatcatcactattgggcttggttcgtggacataaatgg-gggtggcccaatagcagaaacctgata 20510835  T
622 gcaggtagcccaatggatcttgaagagactcagatatcatctta 665  Q
    |||||||||||| ||||||||| |||  ||| |||| |||||||    
20510836 gcaggtagcccagtggatcttggagacgctctgataccatctta 20510879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 71; E-Value: 1e-31
Query Start/End: Original strand, 586 - 739
Target Start/End: Complemental strand, 8098477 - 8098326
Alignment:
586 ataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaa 685  Q
    |||||||  ||||||||||||| ||||||||||||| ||||| |||||| | ||| ||||||| ||| |||| ||| |||||| |||||||||||| |||    
8098477 ataaatgacgggtggcccgataacggaaacctgataacaggtggcccaaagaatcgtgaagaggctctgataccatattagaaatcgtggttgggcttaa 8098378  T
686 cacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||||||||||| || ||||||| |||||||||  || ||||||||||||    
8098377 cacaaccccacaaaaccggcttgtgaggtgaggattg--ccccacttataaaca 8098326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #24
Raw Score: 71; E-Value: 1e-31
Query Start/End: Original strand, 515 - 645
Target Start/End: Complemental strand, 15590169 - 15590039
Alignment:
515 catcttatattcgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaa 614  Q
    ||||| |||||||||||| ||| ||||| ||||| |||||| ||||||||||||||  |||||||||||| |||||||||| || |||||||||||||||    
15590169 catctcatattcgatgtgagactcttaacacaccccctcacgaccagcactattgggtttggttcgtggacataaatggtgagtagcccgatagcggaaa 15590070  T
615 cctgatagcaggtagcccaatggatcttgaa 645  Q
    | ||||||||||| |||||||  ||||||||    
15590069 cttgatagcaggtggcccaataaatcttgaa 15590039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #25
Raw Score: 68; E-Value: 6e-30
Query Start/End: Original strand, 461 - 621
Target Start/End: Original strand, 17015900 - 17016069
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaacat----------cttatattcgatgtgggacgcttaatacaccac 550  Q
    |||||||||||||||||| ||| ||||||| || | ||||||| |||||||||||||          ||| ||| ||||||||||| ||||| ||| | |    
17015900 taacacaaccccacaaaatcggcttgtgaggtgagaattgccctcacttataaacatattgtacaatcttgtatccgatgtgggactcttaacacaac-c 17015998  T
551 ctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgata 621  Q
    ||||| |||| ||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||    
17015999 ctcacgaccaacactattggacttggttcgtggacataaatggtgggtggtccgatagcggaaacctgata 17016069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #26
Raw Score: 66; E-Value: 1e-28
Query Start/End: Original strand, 586 - 739
Target Start/End: Original strand, 21209845 - 21209997
Alignment:
586 ataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaa 685  Q
    |||||||  ||||| ||||||| ||||||||||||| ||||| |||||| | ||| ||||||| |||  ||| ||| |||||| |||||||||||| |||    
21209845 ataaatgacgggtgacccgataacggaaacctgataacaggtggcccaaagaatcgtgaagaggctctaataccatattagaaatcgtggttgggcttaa 21209944  T
686 cacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||||||||||| || ||||||| |||| |||||||| ||||||||||||    
21209945 cacaaccccacaaaaccggcttgtgaggtgagaattgtccc-cacttataaaca 21209997  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #27
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 550 - 696
Target Start/End: Original strand, 11896572 - 11896716
Alignment:
550 cctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagaga 649  Q
    ||||||||||| ||| ||||||||||||||||||| |||  |||||||||| ||||||||| |||||||||| |||||| | |||||||| ||||||||     
11896572 cctcacaaccaacacaattggacttggttcgtggacata--tggtgggtggtccgatagcgaaaacctgataacaggtatctcaatggattttgaagagg 11896669  T
650 ctcagatatcatcttagaactcgtggttgggcctaacacaaccccac 696  Q
     || |||| ||| |||||| ||||||||   ||||||||||||||||    
11896670 ttctgataccatattagaaatcgtggttaaacctaacacaaccccac 11896716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #28
Raw Score: 61; E-Value: 9e-26
Query Start/End: Original strand, 611 - 739
Target Start/End: Original strand, 2063683 - 2063809
Alignment:
611 gaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtg 710  Q
    ||||||||||| || ||   |||||||||||||||||| ||| |||| |||||||||| |||||||||||||||||||||||||||||||| |  |||||    
2063683 gaaacctgataacatgtgatccaatggatcttgaagaggctctgataccatcttagaaatcgtggttgggcctaacacaaccccacaaaaccgacttgtg 2063782  T
711 agatgaggattgtccctcacttataaaca 739  Q
    || ||||||||| ||| ||||||||||||    
2063783 ag-tgaggattg-cccccacttataaaca 2063809  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #29
Raw Score: 60; E-Value: 4e-25
Query Start/End: Original strand, 526 - 648
Target Start/End: Original strand, 11896254 - 11896377
Alignment:
526 cgatgtgggacgcttaatacaccac-ctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagca 624  Q
    ||||||||||| | ||| ||||| | |||||||||| ||||||  | ||||||||||||| ||||||||||||||| ||||||||||||||||||||| |    
11896254 cgatgtgggactcctaacacacccctctcacaaccaacactatcagtcttggttcgtggacataaatggtgggtggtccgatagcggaaacctgatagta 11896353  T
625 ggtagcccaatggatcttgaagag 648  Q
    ||| || |||||||||||| ||||    
11896354 ggtggcacaatggatcttggagag 11896377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #30
Raw Score: 60; E-Value: 4e-25
Query Start/End: Original strand, 526 - 609
Target Start/End: Original strand, 30770148 - 30770231
Alignment:
526 cgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagc 609  Q
    ||||||||||| ||||| ||||| ||||||||||||| ||||||| ||||||||||||| ||||||||||||||||||||||||    
30770148 cgatgtgggactcttaacacaccccctcacaaccagcgctattgggcttggttcgtggacataaatggtgggtggcccgatagc 30770231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #31
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 530 - 648
Target Start/End: Original strand, 13700693 - 13700811
Alignment:
530 gtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtag 629  Q
    ||||||| ||||| |||||  || || |||| |||||||||  ||||||||||   ||||||||||||||||| ||||||||||||||||||||||||      
13700693 gtgggactcttaacacaccttcttacgaccaacactattgggtttggttcgtgatcataaatggtgggtggcctgatagcggaaacctgatagcaggtga 13700792  T
630 cccaatggatcttgaagag 648  Q
    |||||||||||||||||||    
13700793 cccaatggatcttgaagag 13700811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #32
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 562 - 680
Target Start/End: Original strand, 16704618 - 16704736
Alignment:
562 cactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcat 661  Q
    ||||||||| ||||||||||||| ||||||| || ||| ||||||||| ||||| |||||||||||||||||| |||| |||||||  ||| ||||||||    
16704618 cactattgggcttggttcgtggacataaatgatgagtgacccgatagctgaaacatgatagcaggtagcccaaaggatattgaagaagctctgatatcat 16704717  T
662 cttagaactcgtggttggg 680  Q
     |||||| || ||||||||    
16704718 tttagaaatcatggttggg 16704736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #33
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 525 - 639
Target Start/End: Complemental strand, 18885448 - 18885334
Alignment:
525 tcgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagca 624  Q
    |||||||||||| ||||| |||||  ||||| |||||||||||||| |||||||| | || ||||||||||||||| ||||||||| |||||||| ||||    
18885448 tcgatgtgggactcttaacacaccctctcacgaccagcactattgggcttggttcatagacataaatggtgggtggtccgatagcgaaaacctgaaagca 18885349  T
625 ggtagcccaatggat 639  Q
    |||| ||| ||||||    
18885348 ggtaaccctatggat 18885334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #34
Raw Score: 58; E-Value: 6e-24
Query Start/End: Original strand, 654 - 739
Target Start/End: Original strand, 8081105 - 8081190
Alignment:
654 gatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||| |||||||||| || ||||||||||||||||||||||||||||| || ||||||||||||||||| ||| ||||||||||||    
8081105 gataccatcttagaaatcatggttgggcctaacacaaccccacaaaaccggcttgtgagatgaggattgccccccacttataaaca 8081190  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #35
Raw Score: 58; E-Value: 6e-24
Query Start/End: Original strand, 550 - 739
Target Start/End: Complemental strand, 20225237 - 20225049
Alignment:
550 cctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagaga 649  Q
    |||||| ||||| |||||||   |||||| ||||| |||||| || ||  |||||| | |||||||| ||||| | || || |||||||||||||||||     
20225237 cctcacgaccagtactattgagtttggtttgtggatataaatagtagggtgcccgaaaacggaaaccagatagtaagtggcacaatggatcttgaagagg 20225138  T
650 ctcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    ||  |||||||| |||||| |||||||||  ||||||||||||||||||||  |  ||||||| |||||||||| ||||| |||||||||    
20225137 ctatgatatcattttagaaatcgtggttgaacctaacacaaccccacaaaatcgacttgtgaggtgaggattgt-cctcatttataaaca 20225049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #36
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 586 - 722
Target Start/End: Original strand, 29909645 - 29909781
Alignment:
586 ataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaa 685  Q
    |||||||  |||||||| |||| ||||||||||||| ||||| || ||| | ||| ||||||| ||| ||| |||| |||||| | ||||||||||||||    
29909645 ataaatgacgggtggcctgataacggaaacctgataacaggtggctcaaagaatcgtgaagaggctctgatgtcatattagaaatggtggttgggcctaa 29909744  T
686 cacaaccccacaaaactggtttgtgagatgaggattg 722  Q
    |||||| ||||||||| || ||||||| |||||||||    
29909745 cacaactccacaaaaccggcttgtgaggtgaggattg 29909781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #37
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 618 - 737
Target Start/End: Complemental strand, 13296800 - 13296683
Alignment:
618 gatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgag 717  Q
    |||| ||||| |||||| | ||| ||||||| ||| |||| |||||||||| ||||||||||||||||||||| ||||||||||||| ||||||| ||||    
13296800 gataacaggtggcccaaagaatcgtgaagaggctccgataccatcttagaaatcgtggttgggcctaacacaa-cccacaaaactggcttgtgaggtgag 13296702  T
718 gattgtccctcacttataaa 737  Q
    ||||| ||| ||||||||||    
13296701 gattg-cccccacttataaa 13296683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #38
Raw Score: 55; E-Value: 4e-22
Query Start/End: Original strand, 661 - 739
Target Start/End: Original strand, 95265 - 95342
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||| || ||||||||||||||||||||||||||||| || ||||||||||||||||||||| ||||||||||||    
95265 tcttagaattcttggttgggcctaacacaaccccacaaaaccggcttgtgagatgaggattgtccc-cacttataaaca 95342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #39
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 655 - 739
Target Start/End: Complemental strand, 15480650 - 15480565
Alignment:
655 atatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattg-tccctcacttataaaca 739  Q
    |||||||||||||| | |||||||||||||||||||||||||||||| || ||||||| ||||||||| |||| ||||||||||||    
15480650 atatcatcttagaaattgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgatcccccacttataaaca 15480565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #40
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 663 - 739
Target Start/End: Original strand, 27132994 - 27133069
Alignment:
663 ttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||| |||||||||||||||||||||||||||||||| || ||||||| ||||||||| ||||||||||||||||    
27132994 ttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattg-ccctcacttataaaca 27133069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #41
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 661 - 739
Target Start/End: Complemental strand, 28510176 - 28510099
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||| |||||||||||||||||||||||||||||||| || || |||||||||||||| || |||||||||||||    
28510176 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttatgagatgaggattg-ccttcacttataaaca 28510099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #42
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 576 - 699
Target Start/End: Original strand, 2985925 - 2986049
Alignment:
576 gttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatctt-gaagagactcagatatcatcttagaactcgtg 674  Q
    ||||||||| ||||||||||||||||||||||||||||| || |||| | |||||| ||| || ||| | ||||  |  |||| |||||||||| | |||    
2985925 gttcgtggacataaatggtgggtggcccgatagcggaaatcttataggaagtagcctaatagaacttagcagaggttttgataccatcttagaaatggtg 2986024  T
675 gttgggcctaacacaaccccacaaa 699  Q
    |||| ||||||||||||||||||||    
2986025 gttgagcctaacacaaccccacaaa 2986049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #43
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 587 - 701
Target Start/End: Original strand, 17423794 - 17423909
Alignment:
587 taaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatc-ttgaagagactcagatatcatcttagaactcgtggttgggcctaa 685  Q
    |||||||||||| | ||||||||||||||| |||||||||| || |||  |||| |||||||| ||  |||| |||||||||| ||||||||| | ||||    
17423794 taaatggtgggttgtccgatagcggaaaccggatagcaggtggctcaacagatctttgaagaggctttgataccatcttagaagtcgtggttgaggctaa 17423893  T
686 cacaaccccacaaaac 701  Q
    || |||||||||||||    
17423894 cataaccccacaaaac 17423909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #44
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 661 - 740
Target Start/End: Original strand, 20510641 - 20510719
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaacat 740  Q
    |||||||| ||||| |||||||||||||||| ||||||||||||||| |||| ||||||||| ||| |||||||||||||    
20510641 tcttagaaatcgtgtttgggcctaacacaactccacaaaactggtttttgaggtgaggattg-cccccacttataaacat 20510719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #45
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 654 - 736
Target Start/End: Original strand, 1564559 - 1564640
Alignment:
654 gatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataa 736  Q
    ||||||||||||||| ||||||||| ||||||||||||||||||||||||  ||||||  ||||||||| ||| |||||||||    
1564559 gatatcatcttagaaatcgtggttgagcctaacacaaccccacaaaactgtcttgtgatgtgaggattg-cccccacttataa 1564640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #46
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 660 - 722
Target Start/End: Original strand, 25258092 - 25258154
Alignment:
660 atcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattg 722  Q
    ||||||||| |||||||||||||||||||||||||||||||| || ||||||| |||||||||    
25258092 atcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattg 25258154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #47
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 660 - 722
Target Start/End: Original strand, 25321882 - 25321944
Alignment:
660 atcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattg 722  Q
    ||||||||| |||||||||||||||||||||||||||||||| || ||||||| |||||||||    
25321882 atcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattg 25321944  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #48
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 539 - 636
Target Start/End: Complemental strand, 6415879 - 6415782
Alignment:
539 ttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatg 636  Q
    |||| |||| |||||||||||| ||||||||| ||||||||||||| ||||| ||||| || |||||||| ||| || ||||||||||| | ||||||    
6415879 ttaacacacaacctcacaaccaacactattgggcttggttcgtggacataaacggtggatgacccgatagtggagacttgatagcaggtggtccaatg 6415782  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #49
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 439 - 516
Target Start/End: Complemental strand, 24528625 - 24528548
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| || | ||||| | |||||||||||||||||||||| ||||||| || ||||||||||||||||||||||    
24528625 tcttagaaatcatggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaaca 24528548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #50
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 439 - 516
Target Start/End: Complemental strand, 24531684 - 24531607
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| |||| ||||| | |||||||||||||||||| ||| ||||||| || ||||||||||||||||||||||    
24531684 tcttagaaatcgtggttgggcataacacaaccccacaaaatcggcttgtgaggtgaggattgcccccacttataaaca 24531607  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #51
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 439 - 504
Target Start/End: Original strand, 33337454 - 33337519
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccc 504  Q
    |||||||| |||| |||| || ||||||||||||||||||||||||||||||||| ||||||||||    
33337454 tcttagaaatcgtggttgaacctaacacaaccccacaaaaccggtttgtgagatgaggattgcccc 33337519  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #52
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 439 - 516
Target Start/End: Original strand, 35167394 - 35167471
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| |||| ||||| | |||||||||||||||||  |||||||||||||| |||||||||| |||||||||||    
35167394 tcttagaagtcgtggttgggcctaacacaaccccacaaattcggtttgtgagatggggattgccccaacttataaaca 35167471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #53
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 563 - 643
Target Start/End: Complemental strand, 17143311 - 17143231
Alignment:
563 actattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttg 643  Q
    |||||||||||| ||||||||| |||||||||||||||  | ||||||||||| |||||||| ||||| ||| ||||||||    
17143311 actattggacttagttcgtggacataaatggtgggtggttcaatagcggaaacttgatagcaagtagctcaaaggatcttg 17143231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #54
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 441 - 517
Target Start/End: Original strand, 24487646 - 24487722
Alignment:
441 ttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaacat 517  Q
    |||||| |||| ||||| |||||||||||| ||||||||||| ||||||| || ||||| |||||||||||||||||    
24487646 ttagaaatcgtggttgggcttaacacaacctcacaaaaccggcttgtgaggtgaggattacccccacttataaacat 24487722  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #55
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 550 - 722
Target Start/End: Complemental strand, 31974401 - 31974240
Alignment:
550 cctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatctt-gaagag 648  Q
    ||||||| ||| ||||||||| ||||||  ||||| ||||||||||| ||||| |||||| ||||  || |||||||| ||| |||||||||| || |||    
31974401 cctcacacccaacactattgggcttggtgtgtggatataaatggtggatggcctgatagctgaaatttgttagcaggtggcctaatggatcttagaggag 31974302  T
649 actcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattg 722  Q
    |||| |||| |||            ||||||||||||||||||||||||||||||| ||||| | |||||||||    
31974301 actctgataccat------------ggttgggcctaacacaaccccacaaaactggcttgtgcggtgaggattg 31974240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #56
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 441 - 516
Target Start/End: Complemental strand, 8098400 - 8098326
Alignment:
441 ttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||| |||| ||||| |||||||||||||||||||||||| ||||||| || |||||| |||||||||||||||    
8098400 ttagaaatcgtggttgggcttaacacaaccccacaaaaccggcttgtgaggtgaggattg-ccccacttataaaca 8098326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #57
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 660 - 739
Target Start/End: Complemental strand, 13296978 - 13296900
Alignment:
660 atcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    ||||||||| ||||||||||| ||||||||| |||||||||| |||||||||| ||||| ||| ||| ||||||||||||    
13296978 atcttagaaatcgtggttgggtctaacacaatcccacaaaaccggtttgtgaggtgagggttg-cccccacttataaaca 13296900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #58
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 441 - 516
Target Start/End: Original strand, 21209922 - 21209997
Alignment:
441 ttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||| |||| ||||| |||||||||||||||||||||||| ||||||| || | |||| |||||||||||||||    
21209922 ttagaaatcgtggttgggcttaacacaaccccacaaaaccggcttgtgaggtgagaattgtccccacttataaaca 21209997  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #59
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 629 - 740
Target Start/End: Original strand, 24487612 - 24487722
Alignment:
629 gcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctc 728  Q
    |||||| | ||| ||||||| ||| |||| ||| |||||| |||||||||||| |||||||||| |||||||| || ||||||| ||||||||  ||| |    
24487612 gcccaaagaatcgtgaagaggctctgataccatattagaaatcgtggttgggcttaacacaacctcacaaaaccggcttgtgaggtgaggatt-accccc 24487710  T
729 acttataaacat 740  Q
    ||||||||||||    
24487711 acttataaacat 24487722  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #60
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 441 - 516
Target Start/End: Original strand, 27132994 - 27133069
Alignment:
441 ttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||| |||| ||||| | |||||||||||||||||||||| ||||||| || ||||||||| ||||||||||||    
27132994 ttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgccctcacttataaaca 27133069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #61
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 660 - 739
Target Start/End: Complemental strand, 38977019 - 38976941
Alignment:
660 atcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    ||||||||| ||||||||| |||||||||| | ||||||||| |||||||||| |||||||||||||  |||||||||||    
38977019 atcttagaaatcgtggttgtgcctaacacacctccacaaaaccggtttgtgaggtgaggattgtccc-aacttataaaca 38976941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #62
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 661 - 739
Target Start/End: Complemental strand, 12034775 - 12034698
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||| ||||||||||||||||||||| || |||||||||| ||||||| |||||||| |||| || |||||||||    
12034775 tcttagaaatcgtggttgggcctaacacaatcctacaaaactggcttgtgaggtgaggatt-tcccccatttataaaca 12034698  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #63
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 661 - 739
Target Start/End: Original strand, 35167394 - 35167471
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||| ||||||||||||||||||||||||||||||   ||||||||||||| |||||| |||  |||||||||||    
35167394 tcttagaagtcgtggttgggcctaacacaaccccacaaattcggtttgtgagatggggattg-ccccaacttataaaca 35167471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #64
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 439 - 516
Target Start/End: Original strand, 2063733 - 2063809
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| |||| ||||| | |||||||||||||||||||||  ||||||| || ||||||||||||||||||||||    
2063733 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccgacttgtgag-tgaggattgcccccacttataaaca 2063809  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #65
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 527 - 620
Target Start/End: Original strand, 11896135 - 11896228
Alignment:
527 gatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgat 620  Q
    |||||||||| ||||| ||||| |||||| | || | ||||||| |||||||||| || ||||||||||||||  ||||||||| |||||||||    
11896135 gatgtgggactcttaacacaccccctcacgatcatccctattgggcttggttcgttgacataaatggtgggtgatccgatagcgcaaacctgat 11896228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #66
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 439 - 516
Target Start/End: Complemental strand, 13296977 - 13296900
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| |||| |||||   |||||||| ||||||||||||||||||||| || || |||||||||||||||||||    
13296977 tcttagaaatcgtggttgggtctaacacaatcccacaaaaccggtttgtgaggtgagggttgcccccacttataaaca 13296900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #67
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 663 - 740
Target Start/End: Original strand, 26137110 - 26137186
Alignment:
663 ttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaacat 740  Q
    |||||| |||||||| || |||||| ||||||||||||| |||||||||||||||||||| ||| || ||||||||||    
26137110 ttagaaatcgtggttaggtctaacataaccccacaaaaccggtttgtgagatgaggattg-cccccatttataaacat 26137186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #68
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 439 - 516
Target Start/End: Complemental strand, 28510176 - 28510099
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| |||| ||||| | |||||||||||||||||||||| || ||||||| ||||||||  ||||||||||||    
28510176 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttatgagatgaggattgccttcacttataaaca 28510099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #69
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 674 - 722
Target Start/End: Complemental strand, 7092221 - 7092173
Alignment:
674 ggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattg 722  Q
    ||||||||||||||||||||||||||||||| ||||||| |||||||||    
7092221 ggttgggcctaacacaaccccacaaaactggcttgtgaggtgaggattg 7092173  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #70
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 659 - 739
Target Start/End: Complemental strand, 43117969 - 43117890
Alignment:
659 catcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    ||||||| || |||| ||||||||||||||||||| | ||||| || ||||||||||||||||| |||||| |||||||||    
43117969 catcttaaaaatcgttgttgggcctaacacaaccctataaaaccggcttgtgagatgaggattg-ccctcatttataaaca 43117890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #71
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 461 - 516
Target Start/End: Complemental strand, 60150 - 60095
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    ||||| |||||||||||||||| ||||||| || ||||||||||||||||||||||    
60150 taacataaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaaca 60095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #72
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 672 - 739
Target Start/End: Complemental strand, 7369798 - 7369732
Alignment:
672 gtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||||||||||||||||||||||||| || ||||||| |||||| || ||| ||||||||||||    
7369798 gtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggactg-cccccacttataaaca 7369732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #73
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 461 - 516
Target Start/End: Complemental strand, 7369787 - 7369732
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||||||||||||||||| ||||||| || ||| ||||||||||||||||||    
7369787 taacacaaccccacaaaaccggcttgtgaggtgaggactgcccccacttataaaca 7369732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #74
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 461 - 516
Target Start/End: Complemental strand, 9368658 - 9368603
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||||||||||||||||| ||||||| || |||||||| |||||||||||||    
9368658 taacacaaccccacaaaaccggcttgtgaggtgaggattgcctccacttataaaca 9368603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #75
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 673 - 740
Target Start/End: Original strand, 17015890 - 17015956
Alignment:
673 tggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaacat 740  Q
    ||||||||||||||||||||||||||||  || ||||||| |||| |||| |||||||||||||||||    
17015890 tggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagaattg-ccctcacttataaacat 17015956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #76
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 538 - 620
Target Start/End: Original strand, 11896026 - 11896108
Alignment:
538 cttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgat 620  Q
    ||||| ||||| |||||| |||| |||||||||  |||||||| ||| |||||||||||||||  ||||||| ||||||||||    
11896026 cttaacacaccccctcacgaccatcactattgggtttggttcgcggacataaatggtgggtggttcgatagctgaaacctgat 11896108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #77
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 661 - 739
Target Start/End: Complemental strand, 19705988 - 19705911
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||| |||||||||||||||||||||| ||||||||| || || | || ||||||||| ||| ||||||||||||    
19705988 tcttagaaatcgtggttgggcctaacacaactccacaaaaccggcttataaggtgaggattg-cccccacttataaaca 19705911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #78
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 442 - 516
Target Start/End: Complemental strand, 24647778 - 24647704
Alignment:
442 tagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    ||||| |||| ||||||| ||||||||| |||||||||||| ||||||| || |||||||| ||| |||||||||    
24647778 tagaaatcgtggttggacctaacacaactccacaaaaccggcttgtgaggtgaggattgccaccagttataaaca 24647704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #79
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 562 - 615
Target Start/End: Original strand, 2062049 - 2062102
Alignment:
562 cactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaac 615  Q
    |||||||||  |||||||||||| ||||||||||| ||||||||||||||||||    
2062049 cactattgggtttggttcgtggacataaatggtggatggcccgatagcggaaac 2062102  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #80
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 663 - 739
Target Start/End: Complemental strand, 8287884 - 8287810
Alignment:
663 ttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||| | |||||||||||||||||||||||||||||| || ||||||| || ||||||  || ||||||||||||    
8287884 ttagaaattgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtggggattg--ccccacttataaaca 8287810  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #81
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 586 - 739
Target Start/End: Complemental strand, 19522247 - 19522095
Alignment:
586 ataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaa 685  Q
    |||||||  |||||||  |||| |||||| || ||| ||||| ||||||   ||| |||||||  || |||| ||| |||||| ||||||||||| | ||    
19522247 ataaatgacgggtggcttgataacggaaatctcataacaggtggcccaaataatcgtgaagaggttctgataccatattagaaatcgtggttgggtcaaa 19522148  T
686 cacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
     ||||||||||||||| || ||||||| ||||||||| ||| |||| |||||||    
19522147 tacaaccccacaaaaccggcttgtgaggtgaggattg-cccccactaataaaca 19522095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #82
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 439 - 516
Target Start/End: Complemental strand, 19705988 - 19705911
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| |||| ||||| | ||||||||| |||||||||||| || | || || ||||||||||||||||||||||    
19705988 tcttagaaatcgtggttgggcctaacacaactccacaaaaccggcttataaggtgaggattgcccccacttataaaca 19705911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #83
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 660 - 737
Target Start/End: Complemental strand, 21306973 - 21306897
Alignment:
660 atcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaa 737  Q
    ||||||||| ||||||||||| ||||||||| ||||||| || || ||||||| ||||||||| ||| ||||||||||    
21306973 atcttagaaatcgtggttgggtctaacacaatcccacaataccggcttgtgaggtgaggattg-cccccacttataaa 21306897  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #84
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 660 - 737
Target Start/End: Complemental strand, 21314811 - 21314735
Alignment:
660 atcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaa 737  Q
    ||||||||| ||||||||||| ||||||||| ||||||| || || ||||||| ||||||||| ||| ||||||||||    
21314811 atcttagaaatcgtggttgggtctaacacaatcccacaataccggcttgtgaggtgaggattg-cccccacttataaa 21314735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #85
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 663 - 739
Target Start/End: Complemental strand, 7607677 - 7607602
Alignment:
663 ttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||| || ||||||||||||||||||| ||||||||| || ||||||| ||| ||||||| | ||||||||||||    
7607677 ttagaaatcatggttgggcctaacacaactccacaaaaccggcttgtgaggtgaagattgtctc-cacttataaaca 7607602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #86
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 649 - 701
Target Start/End: Original strand, 13701055 - 13701107
Alignment:
649 actcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaac 701  Q
    |||| ||||||||||||||| |||||||| |||||||||| ||||||||||||    
13701055 actctgatatcatcttagaaatcgtggttaggcctaacacgaccccacaaaac 13701107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #87
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 461 - 516
Target Start/End: Original strand, 170572 - 170627
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||||| ||||||||||| ||||||| || ||| ||||||||||||||||||    
170572 taacacaacctcacaaaaccggcttgtgaggtgaggactgcccccacttataaaca 170627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #88
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 461 - 516
Target Start/End: Original strand, 6413447 - 6413502
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||||||||||||| ||| || |||| || ||||||||||||||||||||||    
6413447 taacacaaccccacaaaatcggcttatgaggtgaggattgcccccacttataaaca 6413502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #89
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 461 - 516
Target Start/End: Complemental strand, 8287864 - 8287810
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||||||||||||||||| ||||||| || |||||| |||||||||||||||    
8287864 taacacaaccccacaaaaccggcttgtgaggtggggattg-ccccacttataaaca 8287810  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #90
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 439 - 514
Target Start/End: Complemental strand, 13296757 - 13296683
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaa 514  Q
    |||||||| |||| ||||| | ||||||||||| ||||||| || ||||||| || ||||||||||||||||||||    
13296757 tcttagaaatcgtggttgggcctaacacaaccc-acaaaactggcttgtgaggtgaggattgcccccacttataaa 13296683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #91
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 437 - 516
Target Start/End: Original strand, 16571457 - 16571536
Alignment:
437 agtcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||||| |||| ||||||| ||||| ||||||||||||||  ||| |||| || ||||| |||||||||| |||||    
16571457 agtcttagaaatcgttgttggacctaacataaccccacaaaaccaatttatgaggtgaggatttcccccacttaaaaaca 16571536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #92
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 465 - 516
Target Start/End: Complemental strand, 19522146 - 19522095
Alignment:
465 acaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||||||||||||| ||||||| || |||||||||||||| |||||||    
19522146 acaaccccacaaaaccggcttgtgaggtgaggattgcccccactaataaaca 19522095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #93
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 439 - 514
Target Start/End: Complemental strand, 21306972 - 21306897
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaa 514  Q
    |||||||| |||| |||||   |||||||| ||||||| ||||| ||||||| || ||||||||||||||||||||    
21306972 tcttagaaatcgtggttgggtctaacacaatcccacaataccggcttgtgaggtgaggattgcccccacttataaa 21306897  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #94
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 439 - 514
Target Start/End: Complemental strand, 21314810 - 21314735
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaa 514  Q
    |||||||| |||| |||||   |||||||| ||||||| ||||| ||||||| || ||||||||||||||||||||    
21314810 tcttagaaatcgtggttgggtctaacacaatcccacaataccggcttgtgaggtgaggattgcccccacttataaa 21314735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #95
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 660 - 739
Target Start/End: Original strand, 24346499 - 24346577
Alignment:
660 atcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    ||||||||| | ||||||| |||||||||||||||| ||||| || ||||||| ||||||||  ||| ||||||||||||    
24346499 atcttagaaattgtggttgagcctaacacaaccccataaaaccggcttgtgaggtgaggatt-acccccacttataaaca 24346577  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #96
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 461 - 516
Target Start/End: Original strand, 24346522 - 24346577
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    ||||||||||||| |||||||| ||||||| || ||||| ||||||||||||||||    
24346522 taacacaaccccataaaaccggcttgtgaggtgaggattacccccacttataaaca 24346577  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #97
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 659 - 722
Target Start/End: Complemental strand, 24647783 - 24647720
Alignment:
659 catcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattg 722  Q
    |||| ||||| |||||||||| ||||||||||| ||||||||| || ||||||| |||||||||    
24647783 catcgtagaaatcgtggttggacctaacacaactccacaaaaccggcttgtgaggtgaggattg 24647720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #98
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 461 - 516
Target Start/End: Complemental strand, 42295642 - 42295587
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    ||||||||| |||||||||||| ||||||| || ||||||| ||||||||||||||    
42295642 taacacaactccacaaaaccggcttgtgaggtgaggattgctcccacttataaaca 42295587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #99
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 661 - 739
Target Start/End: Complemental strand, 60172 - 60095
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||| | ||| ||||| |||||| ||||||||||||| || ||||||| ||||||||| ||| ||||||||||||    
60172 tcttagaaattgtgattgggtctaacataaccccacaaaaccggcttgtgaggtgaggattg-cccccacttataaaca 60095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #100
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 657 - 735
Target Start/End: Complemental strand, 15439076 - 15438999
Alignment:
657 atcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttata 735  Q
    ||||||||| || |||||||| ||||||||||||||||| |||||||  ||||||| ||| ||||| ||| ||||||||    
15439076 atcatcttataaatcgtggttaggcctaacacaaccccataaaactgacttgtgaggtgatgattg-cccccacttata 15438999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #101
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 661 - 739
Target Start/End: Original strand, 32908717 - 32908794
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||| ||||||||||| |||||| |||||| |||||| |||||||||| ||| ||||| ||  ||||||||||||    
32908717 tcttagaaatcgtggttgggtctaacataacccctcaaaaccggtttgtgaggtgatgattg-cctccacttataaaca 32908794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #102
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 611 - 739
Target Start/End: Complemental strand, 42295711 - 42295587
Alignment:
611 gaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtg 710  Q
    ||||||||||| ||||| | |||| | ||| ||||||| ||   ||| ||| |||||| | || ||||||||||||||||| ||||||||| || |||||    
42295711 gaaacctgataacaggtggtccaaagaatcgtgaagaggct---ataccatattagaaattgtcgttgggcctaacacaactccacaaaaccggcttgtg 42295615  T
711 agatgaggattgtccctcacttataaaca 739  Q
    || ||||||||| | | ||||||||||||    
42295614 aggtgaggattg-ctcccacttataaaca 42295587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #103
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 674 - 739
Target Start/End: Original strand, 170563 - 170627
Alignment:
674 ggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    ||||||||||||||||||| |||||||| || ||||||| |||||| || ||| ||||||||||||    
170563 ggttgggcctaacacaacctcacaaaaccggcttgtgaggtgaggactg-cccccacttataaaca 170627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #104
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 663 - 724
Target Start/End: Original strand, 21209709 - 21209770
Alignment:
663 ttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtc 724  Q
    |||||| ||||||||| || ||||||||||||||||||| || ||||||| |||| ||||||    
21209709 ttagaaatcgtggttgtgcttaacacaaccccacaaaaccggcttgtgaggtgagaattgtc 21209770  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #105
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 660 - 721
Target Start/End: Original strand, 24269869 - 24269930
Alignment:
660 atcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggatt 721  Q
    ||||||||| | ||||||| |||||||||||||||| ||||| || ||||||| ||||||||    
24269869 atcttagaaattgtggttgagcctaacacaaccccataaaaccggcttgtgaggtgaggatt 24269930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #106
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 461 - 514
Target Start/End: Original strand, 24270126 - 24270179
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaa 514  Q
    |||||||||||||||||||||| ||||||| || | ||| ||||||||||||||    
24270126 taacacaaccccacaaaaccggcttgtgaggtgagtattacccccacttataaa 24270179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #107
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 461 - 514
Target Start/End: Original strand, 24346758 - 24346811
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaa 514  Q
    |||||||||||||||||||||| ||||||| || | ||| ||||||||||||||    
24346758 taacacaaccccacaaaaccggcttgtgaggtgagtattacccccacttataaa 24346811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #108
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 586 - 675
Target Start/End: Original strand, 27133151 - 27133240
Alignment:
586 ataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtgg 675  Q
    |||||||  ||||| ||||||| ||||||||||||| ||||| |||||| | ||| ||||||| ||| |||| ||| |||||| ||||||    
27133151 ataaatgacgggtgacccgataacggaaacctgataacaggtggcccaaagaatcgtgaagaggctctgataccatattagaaatcgtgg 27133240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #109
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 461 - 514
Target Start/End: Original strand, 29909508 - 29909561
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaa 514  Q
    |||||||| |||||||||||| |||||||| || |||||||| |||||||||||    
29909508 taacacaatcccacaaaaccgatttgtgaggtgaggattgcctccacttataaa 29909561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #110
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 461 - 514
Target Start/End: Original strand, 29909742 - 29909795
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaa 514  Q
    ||||||||| |||||||||||| ||||||| || |||||||| |||||||||||    
29909742 taacacaactccacaaaaccggcttgtgaggtgaggattgcctccacttataaa 29909795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #111
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 439 - 516
Target Start/End: Complemental strand, 38977018 - 38976941
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| |||| ||||  | ||||||| | |||||||||||||||||||| || |||||| ||| |||||||||||    
38977018 tcttagaaatcgtggttgtgcctaacacacctccacaaaaccggtttgtgaggtgaggattgtcccaacttataaaca 38976941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #112
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 439 - 516
Target Start/End: Complemental strand, 43117967 - 43117890
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    ||||| || |||| ||||| | ||||||||||| | |||||||| |||||||||| ||||||||| || |||||||||    
43117967 tcttaaaaatcgttgttgggcctaacacaaccctataaaaccggcttgtgagatgaggattgccctcatttataaaca 43117890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #113
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 441 - 516
Target Start/End: Original strand, 6413658 - 6413733
Alignment:
441 ttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||| |||| |||||  |||||||||||||| |||||||| || |||| || |||||| ||| |||||||||||    
6413658 ttagaaatcgttgttgggtttaacacaaccccaaaaaaccggcttatgaggtgaggattgtccctacttataaaca 6413733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #114
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 461 - 508
Target Start/End: Complemental strand, 7092212 - 7092165
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccact 508  Q
    ||||||||||||||||||| || ||||||| || ||||||||||||||    
7092212 taacacaaccccacaaaactggcttgtgaggtgaggattgcccccact 7092165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #115
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 461 - 516
Target Start/End: Complemental strand, 15438940 - 15438885
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    ||||||||||| | |||| ||| ||||||| || ||||||||||||||||||||||    
15438940 taacacaaccctagaaaatcggcttgtgaggtgaggattgcccccacttataaaca 15438885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #116
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 461 - 516
Target Start/End: Original strand, 17352456 - 17352511
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||| ||||| ||||||||||| ||||||| ||  |||||||||||||||||||||    
17352456 taacgcaacctcacaaaaccggcttgtgaggtgatgattgcccccacttataaaca 17352511  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #117
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 597 - 719
Target Start/End: Complemental strand, 29434223 - 29434102
Alignment:
597 gtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggtt-gggcctaacacaacccca 695  Q
    ||||||||||||||||| ||| |||||| || ||||| ||||||||| | || ||| |||| |||||||||| |  ||||| ||||| ||| || |||||    
29434223 gtggcccgatagcggaa-cctaatagcatgtggccca-tggatcttggataggctctgataccatcttagaagttatggtttgggcccaacccagcccca 29434126  T
696 caaaactggtttgtgagatgagga 719  Q
    |||||| || ||||||| ||||||    
29434125 caaaaccggcttgtgaggtgagga 29434102  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #118
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 465 - 516
Target Start/End: Complemental strand, 37405148 - 37405097
Alignment:
465 acaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||||||||||||| || |||| || |||||||||||||||| |||||    
37405148 acaaccccacaaaaccggcttttgaggtggggattgcccccacttacaaaca 37405097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #119
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 439 - 513
Target Start/End: Original strand, 1564566 - 1564640
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataa 513  Q
    |||||||| |||| ||||  | ||||||||||||||||||| |  ||||||  || |||||||||||||||||||    
1564566 tcttagaaatcgtggttgagcctaacacaaccccacaaaactgtcttgtgatgtgaggattgcccccacttataa 1564640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #120
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 661 - 739
Target Start/End: Complemental strand, 9368915 - 9368838
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||| | |||||||||||||||||||||||||| ||  || ||||||  |||| |||| ||| ||||||||||||    
9368915 tcttagaaattgtggttgggcctaacacaaccccacataatcggcttgtgaagtgagaattg-cccccacttataaaca 9368838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #121
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 589 - 722
Target Start/End: Original strand, 35167556 - 35167690
Alignment:
589 aatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaag-agactcagatatcatcttagaactcgtggttgggcctaaca 687  Q
    ||||||||||||| | ||| |  |||| |||||||| |||| | ||  ||||||| || |||||| ||||||||||||||| |||||||||   ||||||    
35167556 aatggtgggtggctcaataacataaacatgatagcatgtagtctaacagatcttggaggagactctgatatcatcttagaaatcgtggttgactctaaca 35167655  T
688 caaccccacaaaactggtttgtgagatgaggattg 722  Q
    || | | | |||| || ||||||| ||||||||||    
35167656 catctctaaaaaaatgctttgtgaaatgaggattg 35167690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #122
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 654 - 699
Target Start/End: Original strand, 1028390 - 1028435
Alignment:
654 gatatcatcttagaactcgtggttgggcctaacacaaccccacaaa 699  Q
    |||| ||| |||||| | ||||||||||||||||||||||||||||    
1028390 gataccatgttagaaatggtggttgggcctaacacaaccccacaaa 1028435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #123
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 654 - 695
Target Start/End: Original strand, 1564501 - 1564542
Alignment:
654 gatatcatcttagaactcgtggttgggcctaacacaacccca 695  Q
    ||||||||||||||| ||||||||| ||| ||||||||||||    
1564501 gatatcatcttagaaatcgtggttgagccaaacacaacccca 1564542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #124
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 463 - 516
Target Start/End: Original strand, 2061961 - 2062014
Alignment:
463 acacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| ||||| ||||| ||||||| ||  |||||||||||||||||||||    
2061961 acacaaccacacaagaccggcttgtgaggtgaagattgcccccacttataaaca 2062014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #125
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 439 - 516
Target Start/End: Complemental strand, 9368915 - 9368838
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| | || ||||| | ||||||||||||||| || ||| ||||||  || | ||||||||||||||||||||    
9368915 tcttagaaattgtggttgggcctaacacaaccccacataatcggcttgtgaagtgagaattgcccccacttataaaca 9368838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #126
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 670 - 739
Target Start/End: Original strand, 16707033 - 16707101
Alignment:
670 tcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    ||||||||||||||||||||||||  ||||||  | ||||||| | ||||||| ||| ||||||||||||    
16707033 tcgtggttgggcctaacacaaccctgcaaaaccagcttgtgaggttaggattg-cccccacttataaaca 16707101  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #127
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 661 - 710
Target Start/End: Complemental strand, 18885548 - 18885499
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtg 710  Q
    |||||||| | ||||||| |||||||||||| |||||||||||| |||||    
18885548 tcttagaaatggtggttgtgcctaacacaactccacaaaactggcttgtg 18885499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #128
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 441 - 490
Target Start/End: Original strand, 21209709 - 21209758
Alignment:
441 ttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgag 490  Q
    |||||| |||| ||||  |||||||||||||||||||||||| |||||||    
21209709 ttagaaatcgtggttgtgcttaacacaaccccacaaaaccggcttgtgag 21209758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #129
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 663 - 708
Target Start/End: Original strand, 24487510 - 24487555
Alignment:
663 ttagaactcgtggttgggcctaacacaaccccacaaaactggtttg 708  Q
    |||||| ||||||||||| |||| ||||||||||||||| ||||||    
24487510 ttagaaatcgtggttgggtctaatacaaccccacaaaaccggtttg 24487555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #130
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 573 - 618
Target Start/End: Complemental strand, 34327562 - 34327517
Alignment:
573 ttggttcgtggaaataaatggtgggtggcccgatagcggaaacctg 618  Q
    |||||||||||| |||||||||||||| | |||||| |||||||||    
34327562 ttggttcgtggacataaatggtgggtgactcgatagtggaaacctg 34327517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #131
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 663 - 716
Target Start/End: Complemental strand, 34328994 - 34328941
Alignment:
663 ttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatga 716  Q
    |||||| ||||| ||||||||||||||||  |||||||| || |||||||||||    
34328994 ttagaaatcgtgattgggcctaacacaacttcacaaaaccggcttgtgagatga 34328941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 131; Significance: 2e-67; HSPs: 113)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 131; E-Value: 2e-67
Query Start/End: Original strand, 439 - 739
Target Start/End: Original strand, 4868576 - 4868889
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaacatcttata-------------tt 525  Q
    |||||||| |||| ||||| | |||||||||||||||||||||| ||||||| || ||||||||||||||||||||||  || |              |     
4868576 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcaggccatgtcctgtc 4868675  T
526 cgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcag 625  Q
    ||||||||||| ||||| ||||| |||||| |||||||||||||| ||||||||||||| |||||||||||||||||||||| |||||||||||||||||    
4868676 cgatgtgggactcttaacacaccccctcacgaccagcactattgggcttggttcgtggacataaatggtgggtggcccgataacggaaacctgatagcag 4868775  T
626 gtagcccaatggatctt-gaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtc 724  Q
    || |||||  ||||||| || ||| ||| |||| |||||||||| |||||||||||||||||||||||||||||||| || ||||||| ||||||||| |    
4868776 gtggcccagcggatcttggaggaggctctgataccatcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattg-c 4868874  T
725 cctcacttataaaca 739  Q
    || ||||||||||||    
4868875 ccccacttataaaca 4868889  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 130; E-Value: 6e-67
Query Start/End: Original strand, 526 - 739
Target Start/End: Complemental strand, 13353421 - 13353209
Alignment:
526 cgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcag 625  Q
    ||||||||||| ||||| ||||| |||||| |||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||| |||    
13353421 cgatgtgggactcttaacacaccccctcacgaccagcactattgggcttggttcgtggacataaatggtgggtggcccgatagcggaaacctgataacag 13353322  T
626 gtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtcc 725  Q
    || ||||||||||||||| |||| ||| |||| |||||||||| | |||||||||||||||||||||||||||||| || |||| || ||||||||| ||    
13353321 gtggcccaatggatcttggagaggctctgataccatcttagaaatggtggttgggcctaacacaaccccacaaaaccggcttgtaaggtgaggattg-cc 13353223  T
726 ctcacttataaaca 739  Q
    | ||||||||||||    
13353222 cccacttataaaca 13353209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 130; E-Value: 6e-67
Query Start/End: Original strand, 526 - 739
Target Start/End: Complemental strand, 33796546 - 33796334
Alignment:
526 cgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcag 625  Q
    ||||||||||| ||||| ||||| |||||| |||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||| |||    
33796546 cgatgtgggactcttaacacaccccctcacgaccagcactattgggcttggttcgtggacataaatggtgggtggcccgatagcggaaacctgataacag 33796447  T
626 gtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtcc 725  Q
    || ||||||||||||||| |||| ||| |||| |||||||||| | |||||||||||||||||||||||||||||| || |||| || ||||||||| ||    
33796446 gtggcccaatggatcttggagaggctctgataccatcttagaaatggtggttgggcctaacacaaccccacaaaaccggcttgtaaggtgaggattg-cc 33796348  T
726 ctcacttataaaca 739  Q
    | ||||||||||||    
33796347 cccacttataaaca 33796334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 119; E-Value: 2e-60
Query Start/End: Original strand, 526 - 740
Target Start/End: Complemental strand, 33494759 - 33494546
Alignment:
526 cgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcag 625  Q
    ||||||||||| ||||| |||||| ||||| |||||||||||||| ||||||||||| | ||||| ||||||||||||||||| ||||||||||||||||    
33494759 cgatgtgggactcttaacacaccaactcacgaccagcactattgggcttggttcgtgaacataaacggtgggtggcccgatagtggaaacctgatagcag 33494660  T
626 gtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtcc 725  Q
    ||  |||||||||||| ||||||  || |||| |||||||||| | |||||||||||||||||||||||||||||| || ||||||| ||||||||| ||    
33494659 gtgacccaatggatctcgaagaggttctgataccatcttagaaatggtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattg-cc 33494561  T
726 ctcacttataaacat 740  Q
    | |||||||||||||    
33494560 cccacttataaacat 33494546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 118; E-Value: 9e-60
Query Start/End: Original strand, 526 - 739
Target Start/End: Original strand, 12330043 - 12330255
Alignment:
526 cgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcag 625  Q
    ||||||||||| ||||| ||||| |||||| |||||||  ||||| ||||||||||||| ||||||||||||||||||||| ||||||||||||||||||    
12330043 cgatgtgggactcttaacacaccccctcacgaccagcataattgggcttggttcgtggacataaatggtgggtggcccgatggcggaaacctgatagcag 12330142  T
626 gtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtcc 725  Q
    || ||||||||||||||| |||| ||| |||| ||| |||||| ||||||||||||||||||||||| |||||||| || ||||||| ||||| ||| ||    
12330143 gtggcccaatggatcttggagaggctctgataccatattagaaatcgtggttgggcctaacacaacctcacaaaaccggcttgtgaggtgagggttg-cc 12330241  T
726 ctcacttataaaca 739  Q
    | ||||||||||||    
12330242 cccacttataaaca 12330255  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 107; E-Value: 3e-53
Query Start/End: Original strand, 439 - 739
Target Start/End: Complemental strand, 9705339 - 9705028
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca---tctta----------tatt 525  Q
    |||||||| |||| |||||   |||||||||||||||||||||| ||||||| || ||||||||||||||||||||||   | |||          |||     
9705339 tcttagaaatcgtggttgggtctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgttaagccatgtcctatc 9705240  T
526 cgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcag 625  Q
    ||||||||||| ||||| ||||| |||||| ||||||||||||||||||||||  |||| ||||||||||||||||||||||  ||||||||||||||||    
9705239 cgatgtgggactcttaacacaccccctcacgaccagcactattggacttggtt--tggacataaatggtgggtggcccgataatggaaacctgatagcag 9705142  T
626 gtagcccaatggatctt-gaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtc 724  Q
    || ||||||   ||||| || ||| ||| |||| |||||||||| | |||||||||||||||||||||||||||||| |  ||||||| ||| ||||| |    
9705141 gtggcccaacaaatcttggaggaggctctgataccatcttagaaatggtggttgggcctaacacaaccccacaaaaccgacttgtgaggtgatgattg-c 9705043  T
725 cctcacttataaaca 739  Q
    || ||||||||||||    
9705042 ccccacttataaaca 9705028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 106; E-Value: 1e-52
Query Start/End: Original strand, 439 - 739
Target Start/End: Original strand, 6542708 - 6543019
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca-------------tcttatatt 525  Q
    |||||||| |||| ||||||||||||||||||| |||||||||||||||||| ||  ||||||||| | |||||||||             |||  |||     
6542708 tcttagaaatcgtggttggacttaacacaaccctacaaaaccggtttgtgaggtgatgattgcccc-atttataaacagattgtcagaccatctcctatc 6542806  T
526 cgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcag 625  Q
    ||||||| ||| ||||| ||||  |||||| |||| |  |||||||||||||||||||| |||||||||||||| ||||||| ||||||||||||||||     
6542807 cgatgtgagactcttaacacacaccctcacgaccaacgatattggacttggttcgtggacataaatggtgggtgacccgataacggaaacctgatagcaa 6542906  T
626 gtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtcc 725  Q
    ||  ||||||||||||||||||| ||| |||| |||||| ||| ||||||||||| |||||||||||||||||||| || || |||| ||| ||||| ||    
6542907 gtgacccaatggatcttgaagaggctctgataccatctttgaaatcgtggttgggtctaacacaaccccacaaaaccggcttctgaggtgatgattg-cc 6543005  T
726 ctcacttataaaca 739  Q
    | ||||||||||||    
6543006 cccacttataaaca 6543019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 88; E-Value: 7e-42
Query Start/End: Original strand, 439 - 657
Target Start/End: Original strand, 17147659 - 17147890
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaa-------------catcttatatt 525  Q
    |||||||| | || ||||||| ||||| |||||||||||||||| ||||||| || ||||||||||||||||||||             ||| |  |||     
17147659 tcttagaaatggtggttggacctaacataaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaatacattgtcaggtcatgtcctatc 17147758  T
526 cgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcag 625  Q
    ||||||||||| ||||| ||||| ||||||||||||||||||||| ||||||||||||| |||||||||||||| || ||||||||||||||||||||||    
17147759 cgatgtgggactcttaacacaccccctcacaaccagcactattgggcttggttcgtggacataaatggtgggtgacctgatagcggaaacctgatagcag 17147858  T
626 gtagcccaatggatcttgaagagactcagata 657  Q
    ||  |||||||||| ||| |||| ||| ||||    
17147859 gtgacccaatggatgttggagaggctctgata 17147890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 85; E-Value: 4e-40
Query Start/End: Original strand, 441 - 739
Target Start/End: Complemental strand, 30256895 - 30256586
Alignment:
441 ttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaacatcttat-------------attcg 527  Q
    |||||| |||| ||||| | |||||||||||||||||||||| ||||||| || |||||||||| |||||||||||| || |             || ||    
30256895 ttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccc-acttataaacatattgtcaggtcatcacctatccg 30256797  T
528 atgtgggacgcttaat-acaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcagg 626  Q
    ||||||||| |||||  ||||| | |||| |||| |||| |||| ||| ||||||||| |||||||| ||||||| ||||| || ||||||||||||| |    
30256796 atgtgggactcttaaacacaccccatcacgaccaacactgttgggcttagttcgtggacataaatgg-gggtggctcgatatcgaaaacctgatagcatg 30256698  T
627 tagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccc 726  Q
      ||||||||||| ||| | || ||| |||| || ||||||| |||||||||||||||||||||||||||||||| |||||||||| ||||||||| |||    
30256697 cggcccaatggattttggaaaggctctgataccaccttagaaatcgtggttgggcctaacacaaccccacaaaaccggtttgtgagttgaggattg-ccc 30256599  T
727 tcacttataaaca 739  Q
     || |||||||||    
30256598 ccagttataaaca 30256586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 83; E-Value: 7e-39
Query Start/End: Original strand, 521 - 739
Target Start/End: Complemental strand, 3680236 - 3680020
Alignment:
521 atattcgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgat 620  Q
    |||| ||||||||||| ||||| || || |||||| |||| ||||||||| ||||||| ||||| ||||||||||| || ||||||||||||||||| ||    
3680236 atatccgatgtgggactcttaacacccc-cctcacgaccaacactattgggcttggtttgtggacataaatggtggatgacccgatagcggaaacctaat 3680138  T
621 agcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggat 720  Q
    |||||||  ||| |||||| ||| ||||  || |||| |||||||||| | |||||||||||||||||||||||||||||  |  |||||||| ||||||    
3680137 agcaggtgacccgatggattttggagagggtctgataccatcttagaaattgtggttgggcctaacacaaccccacaaaatcgacttgtgagaggaggat 3680038  T
721 tgtccctcacttataaaca 739  Q
    || ||| || |||||||||    
3680037 tg-cccccagttataaaca 3680020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 78; E-Value: 7e-36
Query Start/End: Original strand, 439 - 739
Target Start/End: Complemental strand, 6054488 - 6054177
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaa-------------catcttatatt 525  Q
    |||||||| |||| |||||   ||||||||||| |||||| ||||||||||| || ||||||||||||||||||||             |||||  |||     
6054488 tcttagaaatcgtggttgggtctaacacaaccctacaaaatcggtttgtgaggtgaggattgcccccacttataaataccttgtcagaccatctcttatc 6054389  T
526 cgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcag 625  Q
    |||||| |||| ||||| ||||| | |||| |||| || ||||||  ||||||| |||| ||||| ||| ||||  || |||||||||||||||||||||    
6054388 cgatgttggactcttaacacaccccgtcacgaccatcattattggt-ttggttcatggacataaacggtcggtgatccaatagcggaaacctgatagcag 6054290  T
626 gtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtcc 725  Q
    || ||| |||| |||||||||||  || ||||||||||||||| ||||||||| | ||||||| | ||||||||||||  || |||| ||| |||||| |    
6054289 gtggcctaatgaatcttgaagaggttctgatatcatcttagaaatcgtggttgagtctaacacgatcccacaaaactgacttatgaggtgatgattgt-c 6054191  T
726 ctcacttataaaca 739  Q
    ||||||||||||||    
6054190 ctcacttataaaca 6054177  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 78; E-Value: 7e-36
Query Start/End: Original strand, 550 - 739
Target Start/End: Original strand, 33631693 - 33631880
Alignment:
550 cctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagaga 649  Q
    |||||| |||||||||||||  ||||||| ||||| |||||||||||||| ||||||||| ||||||||||| |||||  |||||| ||||||| |||      
33631693 cctcacgaccagcactattgagcttggttagtggacataaatggtgggtgtcccgatagcagaaacctgatatcaggtgacccaatagatcttggagatg 33631792  T
650 ctcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    ||| |||||||||||| || || ||||||| |||||| |||||||||||||| || || |||| |||||||||| || ||||||||||||    
33631793 ctctgatatcatcttaaaaatcatggttggacctaactcaaccccacaaaaccgg-ttatgaggtgaggattgttcc-cacttataaaca 33631880  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 71; E-Value: 1e-31
Query Start/End: Original strand, 521 - 739
Target Start/End: Complemental strand, 13740906 - 13740689
Alignment:
521 atattcgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgat 620  Q
    |||| |||||||| || |||||||||||  ||||| ||||| | ||||| |||||||| ||||| |||||| |||||||||||||||| | |||||||||    
13740906 atatccgatgtggaactcttaatacaccctctcacgaccagtaatattgaacttggtttgtggatataaattgtgggtggcccgatagggaaaacctgat 13740807  T
621 agcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggat 720  Q
    ||  |||  || ||||||||||| |||| |||  |||| || |||||| ||||||||| ||||||||||||| |||||||| |  || ||||  ||||||    
13740806 agatggtgacctaatggatcttgcagaggctctaatataatattagaaatcgtggttgagcctaacacaacctcacaaaaccgacttatgaggcgaggat 13740707  T
721 tgtccctcacttataaaca 739  Q
    |||| | ||||||||||||    
13740706 tgtctc-cacttataaaca 13740689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 71; E-Value: 1e-31
Query Start/End: Original strand, 521 - 739
Target Start/End: Complemental strand, 13746406 - 13746189
Alignment:
521 atattcgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgat 620  Q
    |||| |||||||| || |||||||||||  ||||| ||||| | ||||| |||||||| ||||| |||||| |||||||||||||||| | |||||||||    
13746406 atatccgatgtggaactcttaatacaccctctcacgaccagtaatattgaacttggtttgtggatataaattgtgggtggcccgatagggaaaacctgat 13746307  T
621 agcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggat 720  Q
    ||  |||  || ||||||||||| |||| |||  |||| || |||||| ||||||||| ||||||||||||| |||||||| |  || ||||  ||||||    
13746306 agatggtgacctaatggatcttgcagaggctctaatataatattagaaatcgtggttgagcctaacacaacctcacaaaaccgacttatgaggcgaggat 13746207  T
721 tgtccctcacttataaaca 739  Q
    |||| | ||||||||||||    
13746206 tgtctc-cacttataaaca 13746189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 69; E-Value: 2e-30
Query Start/End: Original strand, 573 - 737
Target Start/End: Original strand, 6237618 - 6237776
Alignment:
573 ttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcg 672  Q
    |||||||||||| ||||||||||||||| ||||||||||||||||| ||||| || | ||||||||||||||||||||||  ||| |||||||||| |||    
6237618 ttggttcgtggacataaatggtgggtggtccgatagcggaaacctggtagcaagtggtccaatggatcttgaagagactctaataccatcttagaagtcg 6237717  T
673 tggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaa 737  Q
    || ||| | ||||||||||| |     || || ||||||| ||||||||| ||||||||||||||    
6237718 tgattgagtctaacacaacctc-----accggcttgtgaggtgaggattg-ccctcacttataaa 6237776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 69; E-Value: 2e-30
Query Start/End: Original strand, 553 - 737
Target Start/End: Complemental strand, 24554309 - 24554127
Alignment:
553 cacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactc 652  Q
    ||||| ||||| |||||  |||||||||| || ||||||||||||||| | |||||||| ||||||||||||||| | ||||||||||||||||| ||||    
24554309 cacaatcagcattattgagcttggttcgttgacataaatggtgggtggtctgatagcggtaacctgatagcaggt-ggccaatggatcttgaagacactc 24554211  T
653 agatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaa 737  Q
     |||| ||| |||||| |  |||||| | |||||||||| ||||||||| || ||||||| ||| ||||| ||| ||||||||||    
24554210 tgataccatgttagaaattatggttgagactaacacaactccacaaaaccggcttgtgaggtgaagattg-cccccacttataaa 24554127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 527 - 661
Target Start/End: Complemental strand, 31961162 - 31961028
Alignment:
527 gatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcagg 626  Q
    |||||||||| ||||| ||| | |||||| || || |||||||| |||||| |||||| |||||||||||| ||| ||||||| ||||||||||||||||    
31961162 gatgtgggactcttaacacatcccctcacgactagtactattgggcttggtccgtggacataaatggtggggggcacgatagcagaaacctgatagcagg 31961063  T
627 tagcccaatggatcttgaagagactcagatatcat 661  Q
    | ||||||||||||||| |||| ||| ||||||||    
31961062 tggcccaatggatcttggagaggctctgatatcat 31961028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 66; E-Value: 1e-28
Query Start/End: Original strand, 526 - 740
Target Start/End: Original strand, 6400719 - 6400923
Alignment:
526 cgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcag 625  Q
    ||||||| ||| ||||| || || |||||| |||||||||||||| ||||||||||||| ||||||||||||||| |||||||| |||||||||||||||    
6400719 cgatgtgagactcttaacaccccccctcacgaccagcactattgggcttggttcgtggacataaatggtgggtggtccgatagcagaaacctgatagcag 6400818  T
626 gtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtcc 725  Q
    || | || || ||| ||| |||| ||  |||| ||||||| || ||||||||||||        |||||||||||| || ||||||| ||||||||| ||    
6400819 gt-gacccatagattttggagaggctttgataccatcttaaaaatcgtggttgggc--------accccacaaaaccggcttgtgaggtgaggattg-cc 6400908  T
726 ctcacttataaacat 740  Q
      |||||||||||||    
6400909 tccacttataaacat 6400923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 602 - 739
Target Start/End: Complemental strand, 8026533 - 8026397
Alignment:
602 ccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaac 701  Q
    |||||| || |||||||||| ||||| ||||||   ||| ||||||| ||| |||| ||| |||||| ||||||||||||||||||||||||||||||||    
8026533 ccgataacgaaaacctgataacaggtggcccaacaaatcgtgaagaggctctgataccatattagaaatcgtggttgggcctaacacaaccccacaaaac 8026434  T
702 tggtttgtgagatgaggattgtccctcacttataaaca 739  Q
     || ||||||| ||||||||| ||| ||||||||||||    
8026433 cggcttgtgaggtgaggattg-cccccacttataaaca 8026397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 551 - 700
Target Start/End: Complemental strand, 32290923 - 32290774
Alignment:
551 ctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagac 650  Q
    ||||| ||||||| |||||| |||| || ||||| ||||||||||||||||||||||||| ||| ||||||| |||| |||| |||||| ||| |||  |    
32290923 ctcacgaccagcattattgggcttgatttgtggacataaatggtgggtggcccgatagcgaaaatctgatagtaggtggcccgatggatattggagatgc 32290824  T
651 tcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaa 700  Q
    ||  ||| |||||||||| |||| ||| ||||||||||||||| ||||||    
32290823 tctaataccatcttagaaatcgttgtttggcctaacacaaccctacaaaa 32290774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 61; E-Value: 9e-26
Query Start/End: Original strand, 586 - 739
Target Start/End: Complemental strand, 19712876 - 19712722
Alignment:
586 ataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaa 685  Q
    |||||||  ||||| ||| ||| ||||||||||||| ||||| |||||| | ||| ||||||| ||| |||| |||||||||| | ||||||||||||||    
19712876 ataaatgacgggtgacccaataacggaaacctgataacaggtggcccaaagaatcgtgaagaggctctgataccatcttagaaatggtggttgggcctaa 19712777  T
686 --cacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
      |||||||||||||||| || ||||||| ||||||||| ||| ||||||||||||    
19712776 cacacaaccccacaaaaccggcttgtgaggtgaggattg-cccccacttataaaca 19712722  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #22
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 597 - 739
Target Start/End: Complemental strand, 21690871 - 21690730
Alignment:
597 gtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccac 696  Q
    ||||||||||| ||||||| ||||| ||||| |||||| | ||| ||||||| ||  |||| ||| |||||| ||||||||| |||||||||||||||||    
21690871 gtggcccgataacggaaacatgataacaggtggcccaaagaatcgtgaagaggctttgataccatattagaaatcgtggttgagcctaacacaaccccac 21690772  T
697 aaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    ||||  || ||||||| ||||||||| ||| ||||||||||||    
21690771 aaaatcggcttgtgaggtgaggattg-cccccacttataaaca 21690730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #23
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 572 - 740
Target Start/End: Original strand, 7638758 - 7638925
Alignment:
572 cttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactc 671  Q
    |||||||||| || ||||||| ||||||  | ||||||||||||||||||||||||   ||||| ||||||| |||  ||| |||||| |||||||| ||    
7638758 cttggttcgtagacataaatgatgggtgatctgatagcggaaacctgatagcaggtgatccaatagatcttggagaagctctgatatcttcttagaaatc 7638857  T
672 gtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaacat 740  Q
     | ||||| |||||||||||| ||||||||  | ||||||| ||| |||||| ||||| ||||||||||    
7638858 atagttggacctaacacaaccgcacaaaaccagcttgtgaggtgaagattgt-cctcatttataaacat 7638925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #24
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 575 - 722
Target Start/End: Original strand, 30849315 - 30849462
Alignment:
575 ggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtg 674  Q
    |||||||||| |||||||||| ||||| |  |||||||||||| ||||||||| | |||||||||||| ||| ||||  ||||||||||||||| ||||     
30849315 ggttcgtggacataaatggtgagtggctcattagcggaaacctaatagcaggtggtccaatggatcttaaagggactttgatatcatcttagaaatcgta 30849414  T
675 gttgggcctaacacaaccccacaaaactggtttgtgagatgaggattg 722  Q
     || || ||| |||||||||||||||| || ||| ||  |||||||||    
30849415 attaggtctagcacaaccccacaaaaccggcttgcgatgtgaggattg 30849462  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #25
Raw Score: 55; E-Value: 4e-22
Query Start/End: Original strand, 515 - 701
Target Start/End: Complemental strand, 34345628 - 34345443
Alignment:
515 catcttatattcgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaa 614  Q
    ||||| |||||||||||||||| ||||| ||||| |||||  |||| ||||||||   |||||||||||| ||||||| |  |||| |||||| | ||||    
34345628 catctcatattcgatgtgggactcttaacacaccccctcatgaccaacactattgtgtttggttcgtggacataaatgataagtggtccgataactgaaa 34345529  T
615 cctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaac 701  Q
    ||||||||||||| || |||| ||| || ||||| ||| ||||| ||||||||| |||||| |||  |||| |||||  ||||||||    
34345528 cctgatagcaggtggctcaatagat-ttaaagaggctctgatattatcttagaaatcgtggctggagctaaaacaacttcacaaaac 34345443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #26
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 586 - 739
Target Start/End: Original strand, 5572540 - 5572691
Alignment:
586 ataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaa 685  Q
    |||||||  ||||||||||||| ||||||||||||| ||||  |||||| | ||| ||||||| ||| |||| ||| |||||| ||||||||||||| ||    
5572540 ataaatgacgggtggcccgataacggaaacctgataacaggcggcccaaagaatcgtgaagaggctctgataccatattagaaatcgtggttgggccgaa 5572639  T
686 cacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    || |||||||| |||| || ||||||| |||||| || ||| ||||||||||||    
5572640 caaaaccccac-aaaccggcttgtgaggtgagga-tggcccccacttataaaca 5572691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #27
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 663 - 739
Target Start/End: Original strand, 8566960 - 8567034
Alignment:
663 ttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||| |||||||||||||||||||||||||||||||| |||||||||| ||||||||||||  ||||||||||||    
8566960 ttagaaatcgtggttgggcctaacacaaccccacaaaaccggtttgtgaggtgaggattgtcc--cacttataaaca 8567034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #28
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 603 - 740
Target Start/End: Complemental strand, 11085724 - 11085588
Alignment:
603 cgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaact 702  Q
    ||||||||||||||||||||||||| |||||| | |||||| |||| |||  | | |||||||||| ||||| |||| |||||||||||| ||||||||     
11085724 cgatagcggaaacctgatagcaggtggcccaacgtatcttggagaggctctaaaaccatcttagaaatcgtgattggacctaacacaaccgcacaaaacc 11085625  T
703 ggtttgtgagatgaggattgtccctcacttataaacat 740  Q
    || ||||||  |||| |||| ||| |||||||||||||    
11085624 ggcttgtgaagtgagaattg-cccccacttataaacat 11085588  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #29
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 609 - 700
Target Start/End: Original strand, 8001496 - 8001588
Alignment:
609 cggaaacctgatagcaggtagcccaatggatcttgaag-agactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaa 700  Q
    ||||||||||||||||||| |||||| ||||||| ||| |||||| |||| |||||||||| | |||||||||||||||||||||| ||||||    
8001496 cggaaacctgatagcaggtggcccaacggatctttaaggagactctgataccatcttagaaattgtggttgggcctaacacaacccaacaaaa 8001588  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #30
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 586 - 739
Target Start/End: Original strand, 15082066 - 15082219
Alignment:
586 ataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaat-ggatctt-gaagagactcagatatcatcttagaactcgtggttgggcct 683  Q
    ||||||||||||||||||||||  |||||||||||||||||| | ||||  ||||||| || |||  || |||| ||| |||||| ||||| ||||||||    
15082066 ataaatggtgggtggcccgataatggaaacctgatagcaggtggtccaaacggatcttagaggaggttctgataccatattagaaatcgtgtttgggcct 15082165  T
684 aacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    ||||||| |||||||||| || ||||||| |||||| ||| |  ||||||||||||    
15082166 aacacaatcccacaaaaccggcttgtgaggtgaggactgttc--cacttataaaca 15082219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #31
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 439 - 517
Target Start/End: Original strand, 25065093 - 25065171
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaacat 517  Q
    |||||||| |||||||||| | |||||||||||||||||||||| ||||||| || |||||||||| ||||||||||||    
25065093 tcttagaaatcgtagttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccctacttataaacat 25065171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #32
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 515 - 657
Target Start/End: Complemental strand, 30505733 - 30505591
Alignment:
515 catcttatattcgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaa 614  Q
    |||||||||| ||||||||||| ||||| || || |||||  |||| |||| |||| |||||||||| || |||||   |||||||| |||||| |||||    
30505733 catcttatatccgatgtgggactcttaacaccccccctcatgaccatcactgttgggcttggttcgtagacataaagaatgggtggcacgataggggaaa 30505634  T
615 cctgatagcaggtagcccaatggatcttgaagagactcagata 657  Q
    |||||||||||||  ||||||| |||||| |||| ||| ||||    
30505633 cctgatagcaggtgacccaatgcatcttggagaggctctgata 30505591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #33
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 659 - 739
Target Start/End: Complemental strand, 11721992 - 11721913
Alignment:
659 catcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||||| |||||||||||||||||||||||||||||||| || || |||| ||||||||| ||| ||||||||||||    
11721992 catcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttatgaggtgaggattg-cccccacttataaaca 11721913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #34
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 615 - 739
Target Start/End: Complemental strand, 27653348 - 27653225
Alignment:
615 cctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagat 714  Q
    ||||||| ||||| ||||||   ||| ||||||| ||| |||| ||| |||||| ||||||||||||||||||||| |||||||||| |  ||||||| |    
27653348 cctgataacaggtggcccaaacaatcgtgaagaggctctgataccatattagaaatcgtggttgggcctaacacaatcccacaaaaccgacttgtgaggt 27653249  T
715 gaggattgtccctcacttataaaca 739  Q
    ||||||| |||| ||||||||||||    
27653248 gaggatt-tcccccacttataaaca 27653225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #35
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 440 - 516
Target Start/End: Complemental strand, 30256662 - 30256586
Alignment:
440 cttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    ||||||| |||| ||||| | |||||||||||||||||||||||||||||| || |||||||||||| |||||||||    
30256662 cttagaaatcgtggttgggcctaacacaaccccacaaaaccggtttgtgagttgaggattgcccccagttataaaca 30256586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #36
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 441 - 516
Target Start/End: Complemental strand, 8026472 - 8026397
Alignment:
441 ttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||| |||| ||||| | |||||||||||||||||||||| ||||||| || ||||||||||||||||||||||    
8026472 ttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaaca 8026397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #37
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 660 - 739
Target Start/End: Original strand, 19639111 - 19639189
Alignment:
660 atcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    ||||||||| |||||||||| ||||||||| |||||| |||| |||||||||| ||||||||||||| ||||||||||||    
19639111 atcttagaaatcgtggttggacctaacacagccccactaaaccggtttgtgaggtgaggattgtccc-cacttataaaca 19639189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #38
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 661 - 740
Target Start/End: Original strand, 25065093 - 25065171
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaacat 740  Q
    |||||||| |||| ||||||||||||||||||||||||||| || ||||||| ||||||||| |||| ||||||||||||    
25065093 tcttagaaatcgtagttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccct-acttataaacat 25065171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #39
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 441 - 516
Target Start/End: Complemental strand, 27772797 - 27772722
Alignment:
441 ttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||| |||| ||||||| ||||||||| |||||||||||| ||||||| || ||||||||||||||||||||||    
27772797 ttagaaatcgtggttggacctaacacaactccacaaaaccggcttgtgaggtgaggattgcccccacttataaaca 27772722  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #40
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 654 - 740
Target Start/End: Complemental strand, 30256904 - 30256820
Alignment:
654 gatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaacat 740  Q
    |||| ||| |||||| |||||||||||||||||||||||||||||||| || ||||||| |||||||||  || |||||||||||||    
30256904 gataccatattagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattg--ccccacttataaacat 30256820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #41
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 439 - 517
Target Start/End: Complemental strand, 33494624 - 33494546
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaacat 517  Q
    |||||||| | || ||||| | |||||||||||||||||||||| ||||||| || |||||||||||||||||||||||    
33494624 tcttagaaatggtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacat 33494546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #42
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 439 - 516
Target Start/End: Complemental strand, 11721990 - 11721913
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| |||| ||||| | |||||||||||||||||||||| || |||| || ||||||||||||||||||||||    
11721990 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttatgaggtgaggattgcccccacttataaaca 11721913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #43
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 663 - 739
Target Start/End: Original strand, 12330292 - 12330366
Alignment:
663 ttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||| ||||||||||||||||||||||| |||||||| || |||||||||||||||||  || ||||||||||||    
12330292 ttagaaatcgtggttgggcctaacacaacctcacaaaaccggcttgtgagatgaggattg--ccccacttataaaca 12330366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #44
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 439 - 516
Target Start/End: Original strand, 19639112 - 19639189
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| |||| ||||||| ||||||| |||||| ||||||||||||||| || |||||| |||||||||||||||    
19639112 tcttagaaatcgtggttggacctaacacagccccactaaaccggtttgtgaggtgaggattgtccccacttataaaca 19639189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #45
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 437 - 509
Target Start/End: Original strand, 6623407 - 6623479
Alignment:
437 agtcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccactt 509  Q
    |||||||||| |||| ||||||| |||||||||||||||||||||| |||| || || |||||||||||||||    
6623407 agtcttagaaatcgtggttggacctaacacaaccccacaaaaccggcttgtaaggtgaggattgcccccactt 6623479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #46
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 580 - 727
Target Start/End: Original strand, 10145667 - 10145815
Alignment:
580 gtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaag-agactcagatatcatcttagaactcgtggttg 678  Q
    ||||| |||||||| ||| || | |||| ||||||||||||||||| | ||  ||  |||| ||||  |||||| ||||||||||||||| | |||||||    
10145667 gtggacataaatggagggcggtctgataacggaaacctgatagcagatggctaaacagatcatgaaccagactctgatatcatcttagaaattgtggttg 10145766  T
679 ggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccct 727  Q
     |||||||||||||| |||||||||  ||||||| |||  |||||||||    
10145767 agcctaacacaaccctacaaaactgacttgtgaggtgaaaattgtccct 10145815  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #47
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 663 - 739
Target Start/End: Complemental strand, 27656541 - 27656466
Alignment:
663 ttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||| | |||||||||||||||||||||||||||||| || ||||||| |||||||| |||| ||||||||||||    
27656541 ttagaaattgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggatt-tcccccacttataaaca 27656466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #48
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 663 - 722
Target Start/End: Complemental strand, 8026687 - 8026628
Alignment:
663 ttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattg 722  Q
    |||||| |||||||||||||||||||||||||||||||| || ||||||| |||||||||    
8026687 ttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattg 8026628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #49
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 551 - 642
Target Start/End: Complemental strand, 20830708 - 20830617
Alignment:
551 ctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatctt 642  Q
    ||||| ||||| | |||||| ||||||||||||||||||||| ||||||  ||||||||  |||||||||||||| || || ||||||||||    
20830708 ctcacgaccagtattattgggcttggttcgtggaaataaatgatgggtgatccgatagcaaaaacctgatagcagataacctaatggatctt 20830617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #50
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 550 - 701
Target Start/End: Complemental strand, 3921755 - 3921603
Alignment:
550 cctcacaaccagcactattggacttggttcgtg--gaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaaga 647  Q
    |||||| |||||||||||||  |||| || |||  || ||||||| |||| ||||| ||||||||||| |||||||||||   |||||||||||||||||    
3921755 cctcacgaccagcactattgagcttgttttgtgtggacataaatgatgggcggccc-atagcggaaacttgatagcaggtgatccaatggatcttgaaga 3921657  T
648 gactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaac 701  Q
    | ||| |||| ||| |||||| || |||||   |||||||| |||| |||||||    
3921656 ggctctgataccatattagaaatcatggttaaacctaacacgaccctacaaaac 3921603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #51
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 661 - 710
Target Start/End: Original strand, 4161845 - 4161894
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtg 710  Q
    |||||||| ||||||||||||||||||||||||||||||||||| |||||    
4161845 tcttagaaatcgtggttgggcctaacacaaccccacaaaactggattgtg 4161894  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #52
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 661 - 710
Target Start/End: Original strand, 4223465 - 4223514
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtg 710  Q
    |||||||| ||||||||||||||||||||||||||||||||||| |||||    
4223465 tcttagaaatcgtggttgggcctaacacaaccccacaaaactggattgtg 4223514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #53
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 439 - 516
Target Start/End: Complemental strand, 13353286 - 13353209
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| | || ||||| | |||||||||||||||||||||| |||| || || ||||||||||||||||||||||    
13353286 tcttagaaatggtggttgggcctaacacaaccccacaaaaccggcttgtaaggtgaggattgcccccacttataaaca 13353209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #54
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 463 - 516
Target Start/End: Complemental strand, 19712775 - 19712722
Alignment:
463 acacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||||||||||||||| ||||||| || ||||||||||||||||||||||    
19712775 acacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaaca 19712722  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #55
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 649 - 722
Target Start/End: Complemental strand, 20373667 - 20373595
Alignment:
649 actcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattg 722  Q
    |||| |||| ||||||| || ||||||||||||||||||||||||||||||| ||| ||||||| |||||||||    
20373667 actctgataccatcttataaatcgtggttgggcctaacacaaccccacaaaa-tggcttgtgaggtgaggattg 20373595  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #56
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 435 - 516
Target Start/End: Complemental strand, 27656547 - 27656466
Alignment:
435 taagtcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    ||||| |||||| | || ||||| | |||||||||||||||||||||| ||||||| || ||||| ||||||||||||||||    
27656547 taagtattagaaattgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggatttcccccacttataaaca 27656466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #57
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 586 - 739
Target Start/End: Complemental strand, 27772872 - 27772722
Alignment:
586 ataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaa 685  Q
    |||||||  |||||| |||||| ||||||||| ||| ||||| || ||| | ||| ||||||| ||  | || ||| |||||| |||||||||| |||||    
27772872 ataaatgacgggtggtccgataacggaaacct-ataacaggtggcgcaaagaatcgtgaagaggcttgg-taccatattagaaatcgtggttggacctaa 27772775  T
686 cacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||| ||||||||| || ||||||| ||||||||| ||| ||||||||||||    
27772774 cacaactccacaaaaccggcttgtgaggtgaggattg-cccccacttataaaca 27772722  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #58
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 539 - 739
Target Start/End: Original strand, 27993518 - 27993719
Alignment:
539 ttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatgga 638  Q
    |||| ||||| | ||||| ||| ||||||||  | |||| | |||| ||||||||| ||||||  |||||||||||||||||   | ||  || ||||||    
27993518 ttaacacacctcttcacacccaacactattgtgcctggtgcatggatataaatggtaggtggcttgatagcggaaacctgatgataagtgacctaatgga 27993617  T
639 tcttgaaga-gactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaa 737  Q
    ||||| ||| ||||| |||| ||| ||| || |||| | |||  ||||||||||| |||||||||   ||||||| |||||||| ||||||| |||||||    
27993618 tcttggagaagactctgataccattttaaaaatcgtagatggatctaacacaacctcacaaaactaagttgtgaggtgaggattttccctcatttataaa 27993717  T
738 ca 739  Q
    ||    
27993718 ca 27993719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #59
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 461 - 514
Target Start/End: Original strand, 28867978 - 28868031
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaa 514  Q
    |||||||||||||||||||||| ||||||| || ||||||||||||||||||||    
28867978 taacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaa 28868031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #60
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 439 - 516
Target Start/End: Complemental strand, 33796411 - 33796334
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| | || ||||| | |||||||||||||||||||||| |||| || || ||||||||||||||||||||||    
33796411 tcttagaaatggtggttgggcctaacacaaccccacaaaaccggcttgtaaggtgaggattgcccccacttataaaca 33796334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #61
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 441 - 516
Target Start/End: Original strand, 8566960 - 8567034
Alignment:
441 ttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||| |||| ||||| | |||||||||||||||||||||||||||||| || ||||||  ||||||||||||||    
8566960 ttagaaatcgtggttgggcctaacacaaccccacaaaaccggtttgtgaggtgaggattg-tcccacttataaaca 8567034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #62
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 441 - 516
Target Start/End: Original strand, 12330180 - 12330255
Alignment:
441 ttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||| |||| ||||| | |||||||||| ||||||||||| ||||||| || || |||||||||||||||||||    
12330180 ttagaaatcgtggttgggcctaacacaacctcacaaaaccggcttgtgaggtgagggttgcccccacttataaaca 12330255  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #63
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 441 - 516
Target Start/End: Original strand, 12330292 - 12330366
Alignment:
441 ttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||| |||| ||||| | |||||||||| ||||||||||| |||||||||| |||||| |||||||||||||||    
12330292 ttagaaatcgtggttgggcctaacacaacctcacaaaaccggcttgtgagatgaggattg-ccccacttataaaca 12330366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #64
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 461 - 516
Target Start/End: Complemental strand, 21690785 - 21690730
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||||||||||||| ||| ||||||| || ||||||||||||||||||||||    
21690785 taacacaaccccacaaaatcggcttgtgaggtgaggattgcccccacttataaaca 21690730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #65
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 453 - 516
Target Start/End: Complemental strand, 27773017 - 27772954
Alignment:
453 gttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    ||||| |||||||||| ||||||||||| | ||||||| || ||||||||||||||||||||||    
27773017 gttgggcttaacacaatcccacaaaaccagcttgtgaggtgaggattgcccccacttataaaca 27772954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #66
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 439 - 517
Target Start/End: Complemental strand, 11085666 - 11085588
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaacat 517  Q
    |||||||| ||||  |||||| |||||||||| ||||||||||| ||||||  || | |||||||||||||||||||||    
11085666 tcttagaaatcgtgattggacctaacacaaccgcacaaaaccggcttgtgaagtgagaattgcccccacttataaacat 11085588  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #67
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 661 - 739
Target Start/End: Complemental strand, 19713037 - 19712960
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||| | ||||||||||||||||||| |||||||||| || ||||||| |||| |||| ||| ||||||||||||    
19713037 tcttagaaatggtggttgggcctaacacaatcccacaaaaccggcttgtgaggtgagaattg-cccccacttataaaca 19712960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #68
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 682 - 739
Target Start/End: Complemental strand, 4906870 - 4906814
Alignment:
682 ctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    ||||||||| |||| |||||||| ||||||||||||||||| ||||||||||||||||    
4906870 ctaacacaatcccataaaactggcttgtgagatgaggattg-ccctcacttataaaca 4906814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #69
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 661 - 722
Target Start/End: Original strand, 6623409 - 6623470
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattg 722  Q
    |||||||| |||||||||| ||||||||||||||||||||| || |||| || |||||||||    
6623409 tcttagaaatcgtggttggacctaacacaaccccacaaaaccggcttgtaaggtgaggattg 6623470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #70
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 441 - 506
Target Start/End: Complemental strand, 8026687 - 8026622
Alignment:
441 ttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgccccca 506  Q
    |||||| |||| ||||| | |||||||||||||||||||||| ||||||| || ||||||||||||    
8026687 ttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgccccca 8026622  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #71
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 439 - 516
Target Start/End: Complemental strand, 19713037 - 19712960
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| | || ||||| | |||||||| ||||||||||||| ||||||| || | ||||||||||||||||||||    
19713037 tcttagaaatggtggttgggcctaacacaatcccacaaaaccggcttgtgaggtgagaattgcccccacttataaaca 19712960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #72
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 572 - 701
Target Start/End: Original strand, 26192558 - 26192687
Alignment:
572 cttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactc 671  Q
    ||||||||||||| ||||||| |||||| |  |||||| ||||| |||||| ||||| ||||||  |  ||  ||||| || ||||||||||||||| ||    
26192558 cttggttcgtggatataaatgatgggtgacgggatagcagaaacatgatagtaggtaacccaataaactttagagagattctgatatcatcttagaaatc 26192657  T
672 gtggttgggcctaacacaaccccacaaaac 701  Q
    ||| ||   |||||||||| ||||||||||    
26192658 gtgattaaacctaacacaatcccacaaaac 26192687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #73
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 664 - 720
Target Start/End: Original strand, 5572386 - 5572442
Alignment:
664 tagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggat 720  Q
    ||||| |||||||||||||||||||||||||||||||| |  ||||||| |||||||    
5572386 tagaaatcgtggttgggcctaacacaaccccacaaaaccgacttgtgaggtgaggat 5572442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #74
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 660 - 739
Target Start/End: Complemental strand, 7915935 - 7915858
Alignment:
660 atcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    ||||||||| ||||||||||| ||||||  |||||||||||  || ||||||| ||||||||| ||| ||||||||||||    
7915935 atcttagaaatcgtggttgggtctaaca--accccacaaaatcggcttgtgaggtgaggattgccccccacttataaaca 7915858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #75
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 661 - 737
Target Start/End: Original strand, 17147659 - 17147734
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaa 737  Q
    |||||||| | |||||||| ||||||| ||||||||||||| || ||||||| ||||||||| ||| ||||||||||    
17147659 tcttagaaatggtggttggacctaacataaccccacaaaaccggcttgtgaggtgaggattg-cccccacttataaa 17147734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #76
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 677 - 737
Target Start/End: Original strand, 28867972 - 28868031
Alignment:
677 tgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaa 737  Q
    ||||||||||||||||||||||||| || ||||||| ||||||||| ||| ||||||||||    
28867972 tgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattg-cccccacttataaa 28868031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #77
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 461 - 516
Target Start/End: Complemental strand, 2753321 - 2753266
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||||||||||||||||  ||||||| || ||||| ||||||||||||||||    
2753321 taacacaaccccacaaaaccgccttgtgaggtgaggattacccccacttataaaca 2753266  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #78
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 441 - 516
Target Start/End: Complemental strand, 27653300 - 27653225
Alignment:
441 ttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||| |||| ||||| | |||||||| ||||||||||||  ||||||| || ||||| ||||||||||||||||    
27653300 ttagaaatcgtggttgggcctaacacaatcccacaaaaccgacttgtgaggtgaggatttcccccacttataaaca 27653225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #79
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 661 - 739
Target Start/End: Original strand, 2736166 - 2736243
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||| ||||||||||| ||||||||| || ||||||   |||| |||| ||||||||||||| ||||||||||||    
2736166 tcttagaaatcgtggttgggtctaacacaatcctacaaaatctgtttatgaggtgaggattgtccc-cacttataaaca 2736243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #80
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 673 - 739
Target Start/End: Complemental strand, 2753331 - 2753266
Alignment:
673 tggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    ||||||||||||||||||||||||||||| |  ||||||| ||||||||  ||| ||||||||||||    
2753331 tggttgggcctaacacaaccccacaaaaccgccttgtgaggtgaggatt-acccccacttataaaca 2753266  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #81
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 442 - 516
Target Start/End: Original strand, 5572386 - 5572460
Alignment:
442 tagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    ||||| |||| ||||| | |||||||||||||||||||||  ||||||| || |||| ||||| |||||||||||    
5572386 tagaaatcgtggttgggcctaacacaaccccacaaaaccgacttgtgaggtgaggatggccccaacttataaaca 5572460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #82
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 660 - 722
Target Start/End: Original strand, 6542707 - 6542769
Alignment:
660 atcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattg 722  Q
    ||||||||| |||||||||| | ||||||||||| ||||||| |||||||||| ||| |||||    
6542707 atcttagaaatcgtggttggacttaacacaaccctacaaaaccggtttgtgaggtgatgattg 6542769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #83
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 673 - 719
Target Start/End: Original strand, 7333093 - 7333139
Alignment:
673 tggttgggcctaacacaaccccacaaaactggtttgtgagatgagga 719  Q
    ||||||||||||||||||||| |||||||||| ||||||| ||||||    
7333093 tggttgggcctaacacaaccctacaaaactggcttgtgaggtgagga 7333139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #84
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 661 - 739
Target Start/End: Complemental strand, 13741001 - 13740924
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||| | |||||||||||||||||||||||||||||| |  ||||||  ||||||||| | | ||||||||||||    
13741001 tcttagaaattgtggttgggcctaacacaaccccacaaaaccgacttgtgaagtgaggattg-ctcccacttataaaca 13740924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #85
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 661 - 739
Target Start/End: Complemental strand, 13746501 - 13746424
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||| | |||||||||||||||||||||||||||||| |  ||||||  ||||||||| | | ||||||||||||    
13746501 tcttagaaattgtggttgggcctaacacaaccccacaaaaccgacttgtgaagtgaggattg-ctcccacttataaaca 13746424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #86
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 561 - 638
Target Start/End: Original strand, 1788841 - 1788918
Alignment:
561 gcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatgga 638  Q
    |||||||||  |||||||| |||| ||||||| |||||  | |||||||||||||| ||||||| |||||| ||||||    
1788841 gcactattgagcttggttcttggacataaatgatgggtaacacgatagcggaaaccagatagcatgtagcctaatgga 1788918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #87
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 439 - 516
Target Start/End: Complemental strand, 3680097 - 3680020
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| | || ||||| | |||||||||||||||||| ||  |||||||| | |||||||||||| |||||||||    
3680097 tcttagaaattgtggttgggcctaacacaaccccacaaaatcgacttgtgagaggaggattgcccccagttataaaca 3680020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #88
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 468 - 517
Target Start/End: Original strand, 6400874 - 6400923
Alignment:
468 accccacaaaaccggtttgtgagatgtggattgcccccacttataaacat 517  Q
    ||||||||||||||| ||||||| || |||||||| ||||||||||||||    
6400874 accccacaaaaccggcttgtgaggtgaggattgcctccacttataaacat 6400923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #89
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 670 - 739
Target Start/End: Original strand, 12329952 - 12330020
Alignment:
670 tcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    ||||||||||||||||||||||| |||||||   | ||||||| ||||||||| ||| ||||||||||||    
12329952 tcgtggttgggcctaacacaacctcacaaaatcagcttgtgaggtgaggattg-cccccacttataaaca 12330020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #90
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 439 - 516
Target Start/End: Complemental strand, 13741001 - 13740924
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| | || ||||| | |||||||||||||||||||||  ||||||  || ||||||| ||||||||||||||    
13741001 tcttagaaattgtggttgggcctaacacaaccccacaaaaccgacttgtgaagtgaggattgctcccacttataaaca 13740924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #91
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 439 - 516
Target Start/End: Complemental strand, 13746501 - 13746424
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| | || ||||| | |||||||||||||||||||||  ||||||  || ||||||| ||||||||||||||    
13746501 tcttagaaattgtggttgggcctaacacaaccccacaaaaccgacttgtgaagtgaggattgctcccacttataaaca 13746424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #92
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 663 - 740
Target Start/End: Original strand, 15081909 - 15081985
Alignment:
663 ttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaacat 740  Q
    |||||| ||||| ||||||||||||||| |||||||||| || ||||||| | ||||||| ||| ||||| |||||||    
15081909 ttagaaatcgtgtttgggcctaacacaatcccacaaaaccggcttgtgagttaaggattg-cccccacttgtaaacat 15081985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #93
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 461 - 514
Target Start/End: Complemental strand, 24554180 - 24554127
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaa 514  Q
    ||||||||| |||||||||||| ||||||| ||  |||||||||||||||||||    
24554180 taacacaactccacaaaaccggcttgtgaggtgaagattgcccccacttataaa 24554127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #94
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 586 - 627
Target Start/End: Original strand, 28648872 - 28648913
Alignment:
586 ataaatggtgggtggcccgatagcggaaacctgatagcaggt 627  Q
    ||||||||||||| |||||||||||||||||| |||||||||    
28648872 ataaatggtgggtagcccgatagcggaaacctaatagcaggt 28648913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #95
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 604 - 692
Target Start/End: Complemental strand, 3713484 - 3713396
Alignment:
604 gatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaacc 692  Q
    |||||||||||| ||||| ||||| | ||||||  ||||| |||| |||   ||||||||||||| | ||||||| |||||||||||||    
3713484 gatagcggaaacttgataccaggtggtccaatgtgtcttggagaggctctcgtatcatcttagaaattgtggttgtgcctaacacaacc 3713396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #96
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 448 - 516
Target Start/End: Original strand, 12329952 - 12330020
Alignment:
448 tcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||| ||||| | |||||||||| ||||||| | | ||||||| || ||||||||||||||||||||||    
12329952 tcgtggttgggcctaacacaacctcacaaaatcagcttgtgaggtgaggattgcccccacttataaaca 12330020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #97
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 461 - 517
Target Start/End: Original strand, 15081929 - 15081985
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaacat 517  Q
    |||||||| ||||||||||||| ||||||| |  ||||||||||||||| |||||||    
15081929 taacacaatcccacaaaaccggcttgtgagttaaggattgcccccacttgtaaacat 15081985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #98
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 661 - 701
Target Start/End: Complemental strand, 16570244 - 16570204
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaac 701  Q
    |||||||| || |||||||||||||||||||||||||||||    
16570244 tcttagaaatcatggttgggcctaacacaaccccacaaaac 16570204  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #99
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 609 - 740
Target Start/End: Complemental strand, 20661010 - 20660878
Alignment:
609 cggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttg 708  Q
    |||| ||||||||| ||||   ||||| ||||||| |||| ||| ||||  ||| ||||| | || ||| ||||||||| ||||||||||| | ||||||    
20661010 cggatacctgatagtaggtgatccaatagatcttggagaggctctgatacaatcatagaatttgtcgttaggcctaacataaccccacaaaccgggtttg 20660911  T
709 tgagatgaggattgtc-cctcacttataaacat 740  Q
    |||  ||||||||| | || |||||||||||||    
20660910 tgatgtgaggattgcctccccacttataaacat 20660878  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #100
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 572 - 740
Target Start/End: Original strand, 30656542 - 30656709
Alignment:
572 cttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactc 671  Q
    |||||||| |||| ||| || ||| ||| |||||||||| |||| |||||||||||  |||||| ||| ||  |||| ||||  |||||||||| ||  |    
30656542 cttggttcatggacatagatcgtgtgtgacccgatagcgaaaacatgatagcaggtgacccaatagattttagagaggctcacgtatcatcttaaaaacc 30656641  T
672 gtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaacat 740  Q
    ||||||||  |||||||||  |  |||||| || ||||||| |||| |||  || ||||||||||||||    
30656642 gtggttggatctaacacaattctccaaaaccggattgtgaggtgagaatt-accttcacttataaacat 30656709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #101
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 461 - 516
Target Start/End: Complemental strand, 4906869 - 4906814
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| |||| ||||| || |||||||||| ||||||||| ||||||||||||    
4906869 taacacaatcccataaaactggcttgtgagatgaggattgccctcacttataaaca 4906814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #102
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 577 - 624
Target Start/End: Original strand, 5648816 - 5648863
Alignment:
577 ttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagca 624  Q
    |||||| | |||||| ||| ||||||||||||||||||||||||||||    
5648816 ttcgtgaacataaatagtgagtggcccgatagcggaaacctgatagca 5648863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #103
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 461 - 516
Target Start/End: Original strand, 6400641 - 6400696
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||||||||||||||||  ||||||  || |||||||| |||||||||||||    
6400641 taacacaaccccacaaaaccgacttgtgatgtgaggattgcctccacttataaaca 6400696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #104
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 672 - 739
Target Start/End: Original strand, 16722817 - 16722883
Alignment:
672 gtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||||||||||||||||||||||||  || ||||||| |||| |||| | | ||||||||||||    
16722817 gtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagaattg-ctcccacttataaaca 16722883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #105
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 461 - 516
Target Start/End: Original strand, 16722828 - 16722883
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||||||||||||| ||| ||||||| || | ||||| ||||||||||||||    
16722828 taacacaaccccacaaaatcggcttgtgaggtgagaattgctcccacttataaaca 16722883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #106
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 661 - 711
Target Start/End: Complemental strand, 10659555 - 10659505
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtga 711  Q
    |||| ||| ||||||||| ||||||||||||||||||||||| | ||||||    
10659555 tcttggaaatcgtggttgagcctaacacaaccccacaaaactagcttgtga 10659505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #107
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 659 - 740
Target Start/End: Original strand, 12199801 - 12199882
Alignment:
659 catcttagaactcgtggtt-gggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaacat 740  Q
    |||||||||| |||||||| ||||||||||||||  |||||||| |  ||||||| ||| ||||| ||| |||||||||||||    
12199801 catcttagaaatcgtggtttgggcctaacacaacatcacaaaacggacttgtgaggtgatgattg-cccccacttataaacat 12199882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #108
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 544 - 642
Target Start/End: Complemental strand, 12648602 - 12648504
Alignment:
544 acaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatctt 642  Q
    ||||| |||||  |||||||  ||||| |||  |||||| | ||||||||| |||| | |||||| |||||| ||||||||| ||| ||||||||||||    
12648602 acacctcctcatgaccagcatcattgggcttaattcgtgaacataaatggtaggtgactcgatagtggaaacttgatagcagatagtccaatggatctt 12648504  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #109
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 660 - 725
Target Start/End: Original strand, 5648670 - 5648735
Alignment:
660 atcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtcc 725  Q
    ||||||||| |  ||||||| |||||||||||| |||||||| || ||||||| ||| ||||||||    
5648670 atcttagaaattatggttggacctaacacaacctcacaaaaccggcttgtgaggtgatgattgtcc 5648735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #110
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 672 - 701
Target Start/End: Complemental strand, 6066049 - 6066020
Alignment:
672 gtggttgggcctaacacaaccccacaaaac 701  Q
    ||||||||||||||||||||||||||||||    
6066049 gtggttgggcctaacacaaccccacaaaac 6066020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #111
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 463 - 516
Target Start/End: Complemental strand, 15600997 - 15600944
Alignment:
463 acacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    ||||||||||||||||| |  ||||||  || ||||||||||||||||||||||    
15600997 acacaaccccacaaaactgacttgtgaagtgaggattgcccccacttataaaca 15600944  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #112
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 461 - 514
Target Start/End: Complemental strand, 20830813 - 20830760
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaa 514  Q
    |||||||||| ||||||| | ||||||||| ||  |||||||||||||||||||    
20830813 taacacaacctcacaaaatcagtttgtgaggtgatgattgcccccacttataaa 20830760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #113
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 467 - 516
Target Start/End: Original strand, 33631638 - 33631687
Alignment:
467 aaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    ||||||||||||||||||| |  | || ||||||||||||||||||||||    
33631638 aaccccacaaaaccggtttatatggtgaggattgcccccacttataaaca 33631687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 127; Significance: 4e-65; HSPs: 166)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 127; E-Value: 4e-65
Query Start/End: Original strand, 521 - 739
Target Start/End: Complemental strand, 20301486 - 20301269
Alignment:
521 atattcgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgat 620  Q
    |||| |||||||| || ||||| ||||| |||||| |||||||||||||| |||||||||| || ||||||||||||||| |||||||||||||||||||    
20301486 atatccgatgtggtactcttaacacaccccctcacgaccagcactattgggcttggttcgtagacataaatggtgggtggtccgatagcggaaacctgat 20301387  T
621 agcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggat 720  Q
    ||||||| |||||||||||||||||||| ||| |||| |||||||||| ||||||||||||||||||||||| |||||||| || ||||||| | |||||    
20301386 agcaggtggcccaatggatcttgaagaggctctgataccatcttagaaatcgtggttgggcctaacacaacctcacaaaacgggcttgtgaggttaggat 20301287  T
721 tgtccctcacttataaaca 739  Q
    || ||| ||||||||||||    
20301286 tg-cccccacttataaaca 20301269  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 127; E-Value: 4e-65
Query Start/End: Original strand, 521 - 739
Target Start/End: Complemental strand, 21088118 - 21087901
Alignment:
521 atattcgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgat 620  Q
    |||| |||||||| || ||||| ||||| |||||| |||||||||||||| |||||||||| || ||||||||||||||| |||||||||||||||||||    
21088118 atatccgatgtggtactcttaacacaccccctcacgaccagcactattgggcttggttcgtagacataaatggtgggtggtccgatagcggaaacctgat 21088019  T
621 agcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggat 720  Q
    ||||||| |||||||||||||||||||| ||| |||| |||||||||| ||||||||||||||||||||||| |||||||| || ||||||| | |||||    
21088018 agcaggtggcccaatggatcttgaagaggctctgataccatcttagaaatcgtggttgggcctaacacaacctcacaaaacgggcttgtgaggttaggat 21087919  T
721 tgtccctcacttataaaca 739  Q
    || ||| ||||||||||||    
21087918 tg-cccccacttataaaca 21087901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 122; E-Value: 4e-62
Query Start/End: Original strand, 526 - 739
Target Start/End: Original strand, 11232293 - 11232505
Alignment:
526 cgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcag 625  Q
    ||||||||||| ||||| ||||| |||||| |||||||||||||| ||||||||||||| |||||||||||||| | ||||||||||||||||||| |||    
11232293 cgatgtgggactcttaacacaccccctcacgaccagcactattgggcttggttcgtggacataaatggtgggtgactcgatagcggaaacctgataacag 11232392  T
626 gtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtcc 725  Q
    || ||||||||||||||| |||| ||| |||| |||||||||| | |||||||||||||||||||||||||||||| || |||| || ||||||||| ||    
11232393 gtggcccaatggatcttggagaggctctgataccatcttagaaatggtggttgggcctaacacaaccccacaaaaccggcttgtaaggtgaggattg-cc 11232491  T
726 ctcacttataaaca 739  Q
    | ||||||||||||    
11232492 cccacttataaaca 11232505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 121; E-Value: 1e-61
Query Start/End: Original strand, 531 - 739
Target Start/End: Complemental strand, 41790873 - 41790667
Alignment:
531 tgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagc 630  Q
    |||||| ||||| ||||| |||||| ||||||||| |||| |||||||| |||| |||||||||||||||| ||||||||||||||||||||||||| ||    
41790873 tgggactcttaacacaccccctcacgaccagcactcttgggcttggttcatggacataaatggtgggtggctcgatagcggaaacctgatagcaggtggc 41790774  T
631 ccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcac 730  Q
    |||||||||||||||||| ||| |||| |||||||||| ||||||||||||||||||||| |||||||||| || || |||| ||||||||||||| |||    
41790773 ccaatggatcttgaagaggctctgataccatcttagaaatcgtggttgggcctaacacaa-cccacaaaaccggcttatgaggtgaggattgtccc-cac 41790676  T
731 ttataaaca 739  Q
    |||||||||    
41790675 ttataaaca 41790667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 118; E-Value: 9e-60
Query Start/End: Original strand, 526 - 739
Target Start/End: Original strand, 39052793 - 39053005
Alignment:
526 cgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcag 625  Q
    ||||||||||| ||||| ||||| |||||| |||| ||||||||| ||||||||||||| ||||||||||||||||| ||||||||||||||||||||||    
39052793 cgatgtgggactcttaacacaccccctcacgaccaacactattgggcttggttcgtggacataaatggtgggtggccggatagcggaaacctgatagcag 39052892  T
626 gtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtcc 725  Q
    |  ||| ||||||||||| |||| |||  ||| |||||||||| |||| ||||||||||||||||||||||||||| || ||||||| ||||||||| ||    
39052893 ggggccaaatggatcttggagaggctctaataccatcttagaaatcgttgttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattg-cc 39052991  T
726 ctcacttataaaca 739  Q
    | ||||||||||||    
39052992 cccacttataaaca 39053005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 114; E-Value: 2e-57
Query Start/End: Original strand, 528 - 737
Target Start/End: Original strand, 3157425 - 3157634
Alignment:
528 atgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggt 627  Q
    ||||| ||| ||||| |||||  ||||| |||||||||||||| ||||||||||||| |||||||||||||| |||||||||| ||||||||||||||||    
3157425 atgtgagactcttaacacacccactcacgaccagcactattgggcttggttcgtggacataaatggtgggtgtcccgatagcgaaaacctgatagcaggt 3157524  T
628 agcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccct 727  Q
     | ||||||||| ||| |||| ||| |||||||||||| || | ||||||| ||||||||||||||||||||||||| ||||||| ||||||||| |||     
3157525 ggtccaatggattttggagaggctctgatatcatcttataaatggtggttgagcctaacacaaccccacaaaactggcttgtgaggtgaggattgccccc 3157624  T
728 cacttataaa 737  Q
    ||||||||||    
3157625 cacttataaa 3157634  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 114; E-Value: 2e-57
Query Start/End: Original strand, 515 - 740
Target Start/End: Original strand, 20094648 - 20094871
Alignment:
515 catcttatattcgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaa 614  Q
    |||||| ||||||||||||||| ||||| || || |||||| |||||||||||||| ||||||||||||| ||||||||||||||||| ||||||| |||    
20094648 catcttctattcgatgtgggactcttaacacgccccctcacgaccagcactattgggcttggttcgtggacataaatggtgggtggcctgatagcgaaaa 20094747  T
615 cctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagat 714  Q
    |||||||| |||| ||||||||||||||||||| |||| |||| || |||| || |||||||||||||||| ||||||||||||||| || |||| || |    
20094748 cctgataggaggtggcccaatggatcttgaagaaactctgataccaacttataaatcgtggttgggcctaa-acaaccccacaaaaccggcttgtaaggt 20094846  T
715 gaggattgtccctcacttataaacat 740  Q
    |||||||| ||| ||| |||||||||    
20094847 gaggattg-cccccacatataaacat 20094871  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 108; E-Value: 8e-54
Query Start/End: Original strand, 439 - 737
Target Start/End: Complemental strand, 8084447 - 8084137
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaa-------------catcttatatt 525  Q
    |||||||| |||| ||||||| |||||||||| |||||||| |||||||||| || || || ||||||||||||||             ||| |  | ||    
8084447 tcttagaaatcgtggttggacctaacacaacctcacaaaactggtttgtgaggtgaggtttacccccacttataaatacattgttaggccatgtcttgtt 8084348  T
526 cgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcag 625  Q
    ||||||||||| ||||| ||||| |||||| |||||||||||||| ||||||||||||| ||||||||||||||  || |||||| |||||||||||||     
8084347 cgatgtgggactcttaacacaccccctcacgaccagcactattgggcttggttcgtggacataaatggtgggtgatccaatagcgaaaacctgatagcat 8084248  T
626 gtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtcc 725  Q
    || ||||||||||||||| |||| ||| |||| |||||||||| ||||||||||| |||||||||| || ||||||  | ||||||| ||||||||| ||    
8084247 gtggcccaatggatcttggagaggctctgataccatcttagaaatcgtggttgggtctaacacaactccgcaaaaccagcttgtgaggtgaggattg-cc 8084149  T
726 ctcacttataaa 737  Q
    | ||||||||||    
8084148 cccacttataaa 8084137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 102; E-Value: 3e-50
Query Start/End: Original strand, 439 - 739
Target Start/End: Complemental strand, 12688392 - 12688080
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca-------------tcttatatt 525  Q
    |||||||| || | ||||||| || |||||||||||||||| || ||||||| |  ||||||||||||||||||||||             |||| |||     
12688392 tcttagaaatcatggttggacctatcacaaccccacaaaactggcttgtgaggtaaggattgcccccacttataaacacattgtcaggtcatcttctatc 12688293  T
526 cgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcag 625  Q
    | ||||||||| ||||  ||||| |||||  |||| ||||||||| ||| ||||||||| |||||||||||||||||| ||||  |||||||||||||||    
12688292 caatgtgggactcttatcacaccccctcatgaccatcactattgggcttagttcgtggacataaatggtgggtggcccaatagaagaaacctgatagcag 12688193  T
626 gtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtcc 725  Q
    || |||||||||||||||||||| |||  |||||||||||||| ||||| ||| | |||||| ||| ||||||||| || ||||||| || |||||| ||    
12688192 gtggcccaatggatcttgaagaggctctaatatcatcttagaaatcgtgtttgagtctaacataactccacaaaaccggcttgtgaggtggggattg-cc 12688094  T
726 ctcacttataaaca 739  Q
    ||||||||||||||    
12688093 ctcacttataaaca 12688080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 96; E-Value: 1e-46
Query Start/End: Original strand, 527 - 701
Target Start/End: Complemental strand, 31197831 - 31197660
Alignment:
527 gatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcagg 626  Q
    |||||||||| |||||  |||| |||||||| |||||||||||  ||||||||||||| ||||||||||||||| |||||||||||||||||||||||||    
31197831 gatgtgggactcttaa--caccccctcacaatcagcactattgagcttggttcgtggacataaatggtgggtggtccgatagcggaaacctgatagcagg 31197734  T
627 tagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaac 701  Q
    | ||||||||||||| | |||| ||| |||| |||||||||| || ||||||||||||||||||||| |||||||    
31197733 tggcccaatggatctcggagaggctctgataccatcttagaaatc-tggttgggcctaacacaaccctacaaaac 31197660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 93; E-Value: 7e-45
Query Start/End: Original strand, 527 - 739
Target Start/End: Original strand, 5932049 - 5932260
Alignment:
527 gatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcagg 626  Q
    |||||||||| ||||| |||||   |||| |||||||||||||  ||||||| || || |||||||||||||||||||||| ||||||| |||||| |||    
5932049 gatgtgggactcttaacacaccctttcacgaccagcactattgcgcttggtttgtcgacataaatggtgggtggcccgataacggaaacgtgatagtagg 5932148  T
627 tagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccc 726  Q
    | | ||||||||||||| |||| ||| |||| ||||||| || | |||||||||||||||||||||||||||||| || ||||||| ||||| ||| |||    
5932149 tggtccaatggatcttggagaggctctgataccatcttaaaaatggtggttgggcctaacacaaccccacaaaacaggcttgtgaggtgaggcttg-ccc 5932247  T
727 tcacttataaaca 739  Q
     ||||||||||||    
5932248 ccacttataaaca 5932260  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 91; E-Value: 1e-43
Query Start/End: Original strand, 593 - 739
Target Start/End: Original strand, 24532352 - 24532497
Alignment:
593 gtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaacc 692  Q
    ||||||||||||||||||||||||||||||||||| |||||||||||||||||| | ||| |||| |||||||||| || ||||||||||||||||||||    
24532352 gtgggtggcccgatagcggaaacctgatagcaggtggcccaatggatcttgaaggggctctgataccatcttagaaatcatggttgggcctaacacaacc 24532451  T
693 ccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    ||||||||| || ||||||| ||| ||||| ||| ||||||||||||    
24532452 ccacaaaaccggcttgtgaggtgatgattg-cccccacttataaaca 24532497  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 84; E-Value: 2e-39
Query Start/End: Original strand, 527 - 665
Target Start/End: Original strand, 18004196 - 18004332
Alignment:
527 gatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcagg 626  Q
    |||||||||| |||||  |||| |||||| |||||||||||| | ||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
18004196 gatgtgggactcttaa--caccccctcacgaccagcactattaggcttggttcgtggacataaatggtgggtggcccgatagcggaaacctgatagcagg 18004293  T
627 tagcccaatggatcttgaagagactcagatatcatctta 665  Q
    | ||||||||||||||| |||| ||| |||| |||||||    
18004294 tggcccaatggatcttggagaggctctgataccatctta 18004332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 83; E-Value: 7e-39
Query Start/End: Original strand, 470 - 739
Target Start/End: Complemental strand, 7669695 - 7669427
Alignment:
470 cccacaaaaccggtttgtgagatgtggattgcccccacttataaacatcttat-attcgatgtgggacgcttaatacaccacctcacaaccagcactatt 568  Q
    |||||||||||   ||||||| || ||||||||||||||||||||||  || | |  | |||||| || ||||| ||||  |||||| |||||||||||     
7669695 cccacaaaaccaacttgtgaggtgaggattgcccccacttataaacacattgtcagaccatgtggaactcttaacacacaccctcacgaccagcactatg 7669596  T
569 ggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaa 668  Q
     | ||||||||||||| ||||||||||||||| ||||||| |||||||||||||||||| || ||||||||||||||||||||  |||| ||||||| ||    
7669595 ag-cttggttcgtggacataaatggtgggtggtccgatagtggaaacctgatagcaggtggctcaatggatcttgaagagactttgataccatcttaaaa 7669497  T
669 ctcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
     | || |    |||||||| |||||||||||||  |||||| |||||| ||||| ||| ||||||||||||    
7669496 attgtcgccatgcctaacataaccccacaaaaccagtttgtaagatgatgattg-cccccacttataaaca 7669427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 83; E-Value: 7e-39
Query Start/End: Original strand, 572 - 739
Target Start/End: Original strand, 15042794 - 15042962
Alignment:
572 cttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagaga--ctcagatatcatcttagaac 669  Q
    ||||||||||||| ||||| ||||||||||| |||||||||||||||||||||||| |||||||| |||||| |||||  ||  |||| ||||||||||     
15042794 cttggttcgtggacataaacggtgggtggcctgatagcggaaacctgatagcaggtggcccaatgaatcttggagagaggctatgataacatcttagaaa 15042893  T
670 tcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||| ||||||||||||||||||||||| |||||  ||| | ||||||| ||| ||||||||||||    
15042894 tcgtggttaggcctaacacaaccccacaaaaccggtttacgaggtaaggattg-cccccacttataaaca 15042962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 82; E-Value: 3e-38
Query Start/End: Original strand, 579 - 739
Target Start/End: Complemental strand, 37001396 - 37001234
Alignment:
579 cgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatct---tgaagagactcagatatcatcttagaactcgtgg 675  Q
    ||||||||| |||| |||||||||||||||||||||||||| ||||||| |||||||||||||   ||||||| ||| |||| |||||| ||| ||||||    
37001396 cgtggaaatgaatgatgggtggcccgatagcggaaacctgacagcaggtggcccaatggatcttgatgaagaggctctgataccatctttgaaatcgtgg 37001297  T
676 ttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||||||||||| ||||||||| || ||||||| ||||||||| ||| ||| ||||||||    
37001296 ttgggcctaacacaactccacaaaaccggcttgtgaggtgaggattg-cccccacctataaaca 37001234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 81; E-Value: 1e-37
Query Start/End: Original strand, 550 - 722
Target Start/End: Original strand, 37868471 - 37868643
Alignment:
550 cctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagaga 649  Q
    |||||| ||||||| |||||| ||||||||||| | |||||||||||||||||| ||||||||||| ||||||| ||| ||||||||||||||| ||||     
37868471 cctcacgaccagcaatattgggcttggttcgtgtacataaatggtgggtggcccaatagcggaaacttgatagcgggtggcccaatggatcttggagagg 37868570  T
650 ctcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattg 722  Q
    ||  |||| ||||||| || |||||||| ||||||||||||  |||||||||  | ||||||| |||||||||    
37868571 ctatgataccatcttaaaaatcgtggttaggcctaacacaattccacaaaaccagcttgtgaggtgaggattg 37868643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 75; E-Value: 4e-34
Query Start/End: Original strand, 544 - 686
Target Start/End: Original strand, 5675938 - 5676080
Alignment:
544 acaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttg 643  Q
    ||||| |||||| ||||||| |||||| |||||||||| || |||||||||||||| ||| ||| || |||||||||||||||| ||| | || ||||||    
5675938 acacctcctcacgaccagcagtattgggcttggttcgtagacataaatggtgggtgacccaatatcgaaaacctgatagcaggtggcctagtgaatcttg 5676037  T
644 aagagactcagatatcatcttagaactcgtggttgggcctaac 686  Q
    ||||||||| ||||||||||||||| |||||||||| ||||||    
5676038 aagagactctgatatcatcttagaaatcgtggttggacctaac 5676080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 75; E-Value: 4e-34
Query Start/End: Original strand, 550 - 700
Target Start/End: Complemental strand, 10615590 - 10615440
Alignment:
550 cctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagaga 649  Q
    |||||| || ||||||||||||||||||||||||| |||||| || |||| ||||||||||||||||||||| ||||| |  |||||||||||| ||||     
10615590 cctcacgactagcactattggacttggttcgtggagataaatagttggtgacccgatagcggaaacctgatatcaggtggtacaatggatcttggagagg 10615491  T
650 ctcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaa 700  Q
    ||| |||| |||||||||| |  ||||| | ||||||||||||||||||||    
10615490 ctctgataccatcttagaaattatggtttgacctaacacaaccccacaaaa 10615440  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 74; E-Value: 2e-33
Query Start/End: Original strand, 598 - 739
Target Start/End: Complemental strand, 4828216 - 4828076
Alignment:
598 tggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccaca 697  Q
    |||||||||| ||||||||||||| ||||| |||||| | ||| ||||||| ||| |||| ||| |||||  ||||||||||||||||||||||||||||    
4828216 tggcccgataacggaaacctgataacaggtggcccaaagaatcgtgaagaggctctgataccatattagagatcgtggttgggcctaacacaaccccaca 4828117  T
698 aaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||| || ||||||| ||||||||||||| ||||||||||||    
4828116 aaaccggcttgtgaggtgaggattgtccc-cacttataaaca 4828076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 74; E-Value: 2e-33
Query Start/End: Original strand, 439 - 643
Target Start/End: Original strand, 35682780 - 35682997
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaacatcttata-------------tt 525  Q
    |||||||| |||| ||||| | |||||||||||||||||||||| ||| ||| || ||||||||||||||||||||||  || |              |     
35682780 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgcgaggtgaggattgcccccacttataaacacattgtcaggccatgtcctgtc 35682879  T
526 cgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcag 625  Q
    |||||||| || ||||| ||  | |||||| |||||||||||||  ||||||||||||| |||||||||||||||||||||||||||||||| |||||||    
35682880 cgatgtggaactcttaacaccacccctcacgaccagcactattgagcttggttcgtggacataaatggtgggtggcccgatagcggaaacctaatagcag 35682979  T
626 gtagcccaatggatcttg 643  Q
    || |||||||||||||||    
35682980 gtggcccaatggatcttg 35682997  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 74; E-Value: 2e-33
Query Start/End: Original strand, 527 - 648
Target Start/End: Original strand, 39052637 - 39052758
Alignment:
527 gatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcagg 626  Q
    |||||||||| ||||| ||||| |||||| |||| ||||||||| ||||||||||||| ||||||||||||||||| |||||||||||||||||||||||    
39052637 gatgtgggactcttaacacaccccctcacgaccaacactattgggcttggttcgtggacataaatggtgggtggccggatagcggaaacctgatagcagg 39052736  T
627 tagcccaatggatcttgaagag 648  Q
    | ||| ||| ||||||| ||||    
39052737 tggccaaattgatcttggagag 39052758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 73; E-Value: 6e-33
Query Start/End: Original strand, 595 - 739
Target Start/End: Original strand, 19256753 - 19256896
Alignment:
595 gggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaacccc 694  Q
    ||||||||||||| ||||||||||||| ||||| |||||| | ||| ||||||| ||| |||| ||| |||||| |||||||||||||||||||||||||    
19256753 gggtggcccgataacggaaacctgataacaggtggcccaaagaatcgtgaagaggctctgataccatattagaaatcgtggttgggcctaacacaacccc 19256852  T
695 acaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||  | ||||||| ||||||||| ||| ||||||||||||    
19256853 acaaaacctgcttgtgaggtgaggattg-cccccacttataaaca 19256896  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 71; E-Value: 1e-31
Query Start/End: Original strand, 526 - 636
Target Start/End: Original strand, 3157108 - 3157218
Alignment:
526 cgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcag 625  Q
    ||||||| ||| ||||| ||||| |||||| |||||||||||||| ||||||||||||| |||||||||||||| |||||||||||||||||||||||||    
3157108 cgatgtgagactcttaacacaccccctcacgaccagcactattgggcttggttcgtggacataaatggtgggtgtcccgatagcggaaacctgatagcag 3157207  T
626 gtagcccaatg 636  Q
    || | ||||||    
3157208 gtggtccaatg 3157218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #25
Raw Score: 71; E-Value: 1e-31
Query Start/End: Original strand, 562 - 739
Target Start/End: Original strand, 8466623 - 8466800
Alignment:
562 cactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaa-gagactcagatatca 660  Q
    ||||||||| |||||| |||| | ||||||||||||||||  |||||||||||||||||||||||| |||||||||||||||||  |  ||  |||| ||    
8466623 cactattgggcttggtgcgtgcatataaatggtgggtggcttgatagcggaaacctgatagcaggtggcccaatggatcttgaaccaagctttgatacca 8466722  T
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||| | ||||||||| |  ||||||||||| |||||  | ||||||| ||||||||||||| ||||||||||||    
8466723 tcttagaaattgtggttgggtcgtacacaaccccataaaaccagcttgtgaggtgaggattgtccc-cacttataaaca 8466800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #26
Raw Score: 71; E-Value: 1e-31
Query Start/End: Original strand, 439 - 627
Target Start/End: Complemental strand, 39960277 - 39960076
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgccccc-acttataaaca-------------tcttatat 524  Q
    |||||||| |||| ||||| | |||||||||||||||||||||| ||||||| || ||||||||||| |||||||||||             |||  |||    
39960277 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaattttcaggccatctcctat 39960178  T
525 tcgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagca 624  Q
     ||||||||||| ||||| || || |||||| |||||||||||||| ||||||||||||| ||||||||||||| || ||||||||||||||||||||||    
39960177 ccgatgtgggactcttaacacccc-cctcacgaccagcactattgggcttggttcgtggacataaatggtgggtagctcgatagcggaaacctgatagca 39960079  T
625 ggt 627  Q
    |||    
39960078 ggt 39960076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #27
Raw Score: 70; E-Value: 4e-31
Query Start/End: Original strand, 586 - 739
Target Start/End: Complemental strand, 16050189 - 16050037
Alignment:
586 ataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaa 685  Q
    |||||||  ||||||||||||| |||||| |||||| ||||| |||||| | ||| ||||||| ||| |||| ||| |||||| ||||||||||| ||||    
16050189 ataaatgacgggtggcccgataacggaaatctgataacaggtggcccaaagaatcgtgaagaggctctgataccatattagaagtcgtggttgggtctaa 16050090  T
686 cacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    ||||||||||||||||||  ||||||| ||||||||| || |||||||||||||    
16050089 cacaaccccacaaaactgacttgtgaggtgaggattg-ccttcacttataaaca 16050037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #28
Raw Score: 66; E-Value: 1e-28
Query Start/End: Original strand, 586 - 739
Target Start/End: Complemental strand, 12317206 - 12317054
Alignment:
586 ataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaa 685  Q
    ||||||| ||||||| |||||| ||||||||||||| ||||| |||||| | ||| ||||||| ||| |||| |||||||||| ||||||||||||||||    
12317206 ataaatgatgggtggtccgataacggaaacctgataacaggtggcccaaagaatcgtgaagagtctctgataccatcttagaaatcgtggttgggcctaa 12317107  T
686 cacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    ||||| |||||||||   | || |||| ||||||||| ||| ||||||||||||    
12317106 cacaatcccacaaaatcagcttatgaggtgaggattg-cccccacttataaaca 12317054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #29
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 539 - 739
Target Start/End: Original strand, 42049563 - 42049763
Alignment:
539 ttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatgga 638  Q
    |||| ||||| |||||| | || ||||||||||||||||||||||| |||||| ||||||||||  ||||||||||   | |||||||  |||||| |||    
42049563 ttaacacaccccctcacgagcaacactattggacttggttcgtggacataaatagtgggtggcctaatagcggaaattaggtagcaggcggcccaacgga 42049662  T
639 tc-ttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaa 737  Q
    || |||| |||  || |||  |||||||||| |||||||| |||||| ||||||| |||||||| || ||||| | ||||||||| ||| ||||||||||    
42049663 tctttgaggaggttctgatgccatcttagaaatcgtggttaggcctaccacaacctcacaaaaccggcttgtggggtgaggattg-cccccacttataaa 42049761  T
738 ca 739  Q
    ||    
42049762 ca 42049763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #30
Raw Score: 61; E-Value: 9e-26
Query Start/End: Original strand, 565 - 700
Target Start/End: Original strand, 422356 - 422491
Alignment:
565 tattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttg-aagagactcagatatcatct 663  Q
    ||||| |||||||||||||| | |||||||||||||||||| ||||||||||||||||||||| ||||||  |||||||    || ||| |||| |||||    
422356 tattgaacttggttcgtggacaaaaatggtgggtggcccgagagcggaaacctgatagcaggtggcccaa-cgatcttgttttaggctctgataccatct 422454  T
664 tagaactcgtggttgggcctaacacaaccccacaaaa 700  Q
    ||||| | ||||||||||| |||||||||||||||||    
422455 tagaaattgtggttgggccaaacacaaccccacaaaa 422491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #31
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 629 - 739
Target Start/End: Original strand, 11232161 - 11232270
Alignment:
629 gcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctc 728  Q
    ||||||||||||||| |||| ||| |||| |||||||||| | |||||||||||||||||||||||||||||| || |||| || ||||||||| ||| |    
11232161 gcccaatggatcttggagaggctctgataccatcttagaaatggtggttgggcctaacacaaccccacaaaaccggcttgtaaggtgaggattg-ccccc 11232259  T
729 acttataaaca 739  Q
    |||||||||||    
11232260 acttataaaca 11232270  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #32
Raw Score: 58; E-Value: 6e-24
Query Start/End: Original strand, 526 - 627
Target Start/End: Original strand, 5675833 - 5675934
Alignment:
526 cgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcag 625  Q
    |||||| |||| ||| | ||||| |||| | |||||||||||||||||||||||||||| |||||||||||||| |||||||||| |||| |||||||||    
5675833 cgatgtaggactctttacacacctcctctcgaccagcactattggacttggttcgtggacataaatggtgggtgacccgatagcgaaaacttgatagcag 5675932  T
626 gt 627  Q
    ||    
5675933 gt 5675934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #33
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 565 - 721
Target Start/End: Original strand, 10614842 - 10614998
Alignment:
565 tattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatctt 664  Q
    |||||| ||||||||||||| | ||||||||| ||  ||||||||  |||| |||| |||||| | ||||||||||||| |||| ||  |||||||||||    
10614842 tattgggcttggttcgtggacacaaatggtggatgttccgatagcaaaaacttgattgcaggtggtccaatggatcttggagaggctatgatatcatctt 10614941  T
665 agaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggatt 721  Q
    | || ||||||||| |||||| ||||||||||||||  || ||||||| ||| ||||    
10614942 ataaatcgtggttgagcctaatacaaccccacaaaatcggcttgtgaggtgaagatt 10614998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #34
Raw Score: 55; E-Value: 4e-22
Query Start/End: Original strand, 661 - 739
Target Start/End: Complemental strand, 39960277 - 39960199
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||| |||||||||||||||||||||||||||||||| || ||||||| ||||||||| ||| ||||||||||||    
39960277 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaaca 39960199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #35
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 576 - 739
Target Start/End: Complemental strand, 8716285 - 8716122
Alignment:
576 gttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaag-agactcagatatcatcttagaactcgtg 674  Q
    ||||||||| ||||||||| |||| ||||||||||||||||| |||||| ||  | ||||||||||| | | || ||| |||| ||| |||||| || ||    
8716285 gttcgtggacataaatggtcggtgacccgatagcggaaacctaatagcatgtgactcaatggatcttaacgaaggctctgataccatattagaaatcttg 8716186  T
675 gttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||| |||||||||||||||||||  || || |||| ||||||||| || |||||| ||||||    
8716185 gttgggtctaacacaaccccacaaaatcggcttatgaggtgaggattg-ccttcacttttaaaca 8716122  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #36
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 586 - 704
Target Start/End: Original strand, 26208172 - 26208291
Alignment:
586 ataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatctt-gaagagactcagatatcatcttagaactcgtggttgggccta 684  Q
    ||||||||||||||||||| ||| | |||||||||||||||| |||||| ||||||| ||  || ||| |||| |||||||||| | |||| ||| ||||    
26208172 ataaatggtgggtggcccgttagggaaaacctgatagcaggtggcccaacggatcttagagaaggctctgataccatcttagaaattgtggatggaccta 26208271  T
685 acacaaccccacaaaactgg 704  Q
    ||||||||||| ||||||||    
26208272 acacaaccccataaaactgg 26208291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #37
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 578 - 721
Target Start/End: Original strand, 36917355 - 36917498
Alignment:
578 tcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggtt 677  Q
    ||||||| ||||||||||| ||| |||||| ||||||||| ||||  |||    |||||||||||| |||| ||| |||| |||||||||| | ||||||    
36917355 tcgtggacataaatggtggatggtccgataacggaaacctaatagtgggtgattcaatggatcttggagaggctctgataccatcttagaaatggtggtt 36917454  T
678 gggcctaacacaaccccacaaaactggtttgtgagatgaggatt 721  Q
    | || |||||||||||||||||||||  ||||||  ||||||||    
36917455 gtgcttaacacaaccccacaaaactgacttgtgatgtgaggatt 36917498  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #38
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 660 - 739
Target Start/End: Complemental strand, 37001550 - 37001472
Alignment:
660 atcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    ||||||||| |||||||||||||||||||||||||||||||| || ||||||  ||||||||||||| ||||||||||||    
37001550 atcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgatgtgaggattgtccc-cacttataaaca 37001472  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #39
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 589 - 739
Target Start/End: Complemental strand, 34842835 - 34842686
Alignment:
589 aatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacac 688  Q
    |||| |||||||||||||| |||||||||| || ||||   ||||| | ||| ||||||| ||| |||| ||| |||||| ||||||||| |||||||||    
34842835 aatgatgggtggcccgataacggaaacctggtaacaggcgacccaaagaatcgtgaagaggctctgataccatattagaaatcgtggttgagcctaacac 34842736  T
689 aaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    ||||||||||||| |   | |||| ||||||||| ||| ||||||||||||    
34842735 aaccccacaaaaccgacctatgaggtgaggattg-cccccacttataaaca 34842686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #40
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 661 - 739
Target Start/End: Original strand, 42846604 - 42846682
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||| |||||||||||||||||||||||||||||||| || ||||||| ||||||||| ||  ||||||||||||    
42846604 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgccctccacttataaaca 42846682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #41
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 654 - 739
Target Start/End: Complemental strand, 10884156 - 10884072
Alignment:
654 gatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||| |||||||||| ||||||||||||||||||||| |||||||||| || ||||||| ||||||||| ||| ||||||||||||    
10884156 gataccatcttagaaatcgtggttgggcctaacacaa-cccacaaaaccggcttgtgaggtgaggattgccccccacttataaaca 10884072  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #42
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 439 - 516
Target Start/End: Original strand, 39052928 - 39053005
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| |||| ||||| | |||||||||||||||||||||| ||||||| || ||||||||||||||||||||||    
39052928 tcttagaaatcgttgttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaaca 39053005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #43
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 663 - 739
Target Start/End: Original strand, 19256587 - 19256662
Alignment:
663 ttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||| |||||||||||||||||||||||||||||||| || ||||||| ||||||||| ||| ||||||||||||    
19256587 ttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattg-cccccacttataaaca 19256662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #44
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 663 - 739
Target Start/End: Original strand, 24075307 - 24075382
Alignment:
663 ttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||| |||||||||||||||||||||||||||||||| || ||||||| ||||||||| ||| ||||||||||||    
24075307 ttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattg-cccccacttataaaca 24075382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #45
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 644 - 739
Target Start/End: Complemental strand, 17469920 - 17469826
Alignment:
644 aagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    ||||| ||| |||| ||| |||||| ||||||||| |||||||||||||||||||||| || ||||||| ||||||||| ||| ||||||||||||    
17469920 aagaggctctgataccatattagaaatcgtggttgagcctaacacaaccccacaaaaccggcttgtgaggtgaggattg-cccccacttataaaca 17469826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #46
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 441 - 516
Target Start/End: Original strand, 19256587 - 19256662
Alignment:
441 ttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||| |||| ||||| | |||||||||||||||||||||| ||||||| || ||||||||||||||||||||||    
19256587 ttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaaca 19256662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #47
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 441 - 516
Target Start/End: Original strand, 24075307 - 24075382
Alignment:
441 ttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||| |||| ||||| | |||||||||||||||||||||| ||||||| || ||||||||||||||||||||||    
24075307 ttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaaca 24075382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #48
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 661 - 739
Target Start/End: Original strand, 35682780 - 35682857
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||| |||||||||||||||||||||||||||||||| || ||| ||| ||||||||| ||| ||||||||||||    
35682780 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgcgaggtgaggattg-cccccacttataaaca 35682857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #49
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 439 - 516
Target Start/End: Original strand, 22638178 - 22638255
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| |||| ||||| |||||||||||||||||||||||| ||||| | || |||||||||| |||||||||||    
22638178 tcttagaaatcgtggttgggcttaacacaaccccacaaaaccggcttgtgtggtgaggattgcccctacttataaaca 22638255  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #50
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 612 - 739
Target Start/End: Original strand, 28213053 - 28213179
Alignment:
612 aaacctgatagcaggtagcccaatggatcttgaag-agactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtg 710  Q
    |||||||||||||||| ||||||  ||||||| || ||  || |||| ||| |||||| ||||||||||||||||||||||||| | ||| ||| |||||    
28213053 aaacctgatagcaggtggcccaacagatcttggaggaggatctgataccatattagaaatcgtggttgggcctaacacaaccccgccaaattggcttgtg 28213152  T
711 agatgaggattgtccctcacttataaaca 739  Q
    || |||||||||  || ||||||||||||    
28213153 aggtgaggattg--ccgcacttataaaca 28213179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #51
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 440 - 516
Target Start/End: Complemental strand, 8929101 - 8929025
Alignment:
440 cttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    ||||||| |||| ||||| | |||||||||||||||||||||| ||||||| || |||||||||||| |||||||||    
8929101 cttagaattcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgcggattgcccccagttataaaca 8929025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #52
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 663 - 739
Target Start/End: Complemental strand, 17477148 - 17477073
Alignment:
663 ttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||| ||||||||| |||||||||||||||||||||| || ||||||| ||||||||| ||| ||||||||||||    
17477148 ttagaaatcgtggttgagcctaacacaaccccacaaaaccggcttgtgaggtgaggattg-cccccacttataaaca 17477073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #53
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 565 - 689
Target Start/End: Original strand, 31079478 - 31079602
Alignment:
565 tattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatctt 664  Q
    |||||| ||||||||||  | ||||||||||||||||||||||| ||||| |||||| || || | ||||||||||||| ||||  |  |||| ||||||    
31079478 tattgggcttggttcgttcacataaatggtgggtggcccgatagtggaaatctgataacatgtggtccaatggatcttgtagaggttttgataccatctt 31079577  T
665 agaactcgtggttgggcctaacaca 689  Q
    |||| || |  ||||||||||||||    
31079578 agaaatctttattgggcctaacaca 31079602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #54
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 526 - 740
Target Start/End: Original strand, 31079661 - 31079876
Alignment:
526 cgatgtgggacgctt-aatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagca 624  Q
    ||||||||||| ||| || ||||| |||||| |||| | ||||||| ||||||||||||| ||||||| ||| ||||||||||| | ||||| | || ||    
31079661 cgatgtgggactctttaacacacctcctcacgaccatccctattgggcttggttcgtggacataaatgatggatggcccgatagtgaaaacccgttaaca 31079760  T
625 ggtagcccaatggatcttga-agagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgt 723  Q
     || ||||||  ||| || | |||| |||  |||  || ||| ||  |||||||| | |||||||| |||||||||||||| || |||| |||||||||     
31079761 tgtggcccaacagattttaacagaggctcttatactatattaaaaaacgtggttgagtctaacacagccccacaaaactggcttttgaggtgaggattg- 31079859  T
724 ccctcacttataaacat 740  Q
    | |||||||||||||||    
31079860 ctctcacttataaacat 31079876  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #55
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 550 - 614
Target Start/End: Original strand, 37867956 - 37868020
Alignment:
550 cctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaa 614  Q
    |||||| |||| ||||||||| ||||||||||||| |||||||||||||||||| ||||||||||    
37867956 cctcacgaccaacactattggccttggttcgtggacataaatggtgggtggcccaatagcggaaa 37868020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #56
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 659 - 739
Target Start/End: Complemental strand, 38475834 - 38475755
Alignment:
659 catcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||||| | |||||||||||||||||||||| ||||||| || ||||||| ||||||||| ||| ||||||||||||    
38475834 catcttagaatttgtggttgggcctaacacaaccctacaaaaccggcttgtgaggtgaggattg-cccccacttataaaca 38475755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #57
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 566 - 710
Target Start/End: Complemental strand, 38476223 - 38476074
Alignment:
566 attggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctg----atagcaggtagcccaatggatcttgaag-agactcagatatca 660  Q
    ||||| || ||| |||||| |||||||||||||||| || |||||||||| ||    |||| | || ||||||||||||||| || || ||| |||| ||    
38476223 attgggctaggtgcgtggatataaatggtgggtggctcggtagcggaaacatgcatgatagtaagtggcccaatggatcttggaggaggctctgatacca 38476124  T
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtg 710  Q
    |||||||| | |||||||||||||||| || |||||||||| || |||||    
38476123 tcttagaaattgtggttgggcctaacataatcccacaaaaccggcttgtg 38476074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #58
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 672 - 739
Target Start/End: Complemental strand, 4828367 - 4828301
Alignment:
672 gtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||||||||||||||||||||||||| || ||||||| ||||||||| ||| ||||||||||||    
4828367 gtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattg-cccccacttataaaca 4828301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #59
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 461 - 516
Target Start/End: Complemental strand, 4828356 - 4828301
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||||||||||||||||| ||||||| || ||||||||||||||||||||||    
4828356 taacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaaca 4828301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #60
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 461 - 516
Target Start/End: Complemental strand, 17469881 - 17469826
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||||||||||||||||| ||||||| || ||||||||||||||||||||||    
17469881 taacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaaca 17469826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #61
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 461 - 516
Target Start/End: Complemental strand, 17477128 - 17477073
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||||||||||||||||| ||||||| || ||||||||||||||||||||||    
17477128 taacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaaca 17477073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #62
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 441 - 516
Target Start/End: Original strand, 19256821 - 19256896
Alignment:
441 ttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||| |||| ||||| | |||||||||||||||||||| | ||||||| || ||||||||||||||||||||||    
19256821 ttagaaatcgtggttgggcctaacacaaccccacaaaacctgcttgtgaggtgaggattgcccccacttataaaca 19256896  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #63
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 661 - 736
Target Start/End: Complemental strand, 27205049 - 27204975
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataa 736  Q
    |||||||| |||||||||||||||||||||||||||||||| || || |||| ||||||||| ||| |||||||||    
27205049 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttatgaggtgaggattg-cccccacttataa 27204975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #64
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 661 - 736
Target Start/End: Complemental strand, 27205147 - 27205073
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataa 736  Q
    |||||||| |||||||||||||||||||||||||||||||| || || |||| ||||||||| ||| |||||||||    
27205147 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttatgaggtgaggattg-cccccacttataa 27205073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #65
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 661 - 736
Target Start/End: Complemental strand, 27205245 - 27205171
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataa 736  Q
    |||||||| |||||||||||||||||||||||||||||||| || || |||| ||||||||| ||| |||||||||    
27205245 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttatgaggtgaggattg-cccccacttataa 27205171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #66
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 461 - 516
Target Start/End: Original strand, 38447448 - 38447503
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||||||||||||||||| ||||||| || ||||||||||||||||||||||    
38447448 taacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaaca 38447503  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #67
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 438 - 516
Target Start/End: Original strand, 42846603 - 42846682
Alignment:
438 gtcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgccc-ccacttataaaca 516  Q
    ||||||||| |||| ||||| | |||||||||||||||||||||| ||||||| || ||||||||| |||||||||||||    
42846603 gtcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgccctccacttataaaca 42846682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #68
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 661 - 739
Target Start/End: Original strand, 3157326 - 3157403
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||| | ||||||||||||||||||||||||||||||  | ||||||| ||||||||| ||| ||||||||||||    
3157326 tcttagaaatggtggttgggcctaacacaaccccacaaaac-agcttgtgaggtgaggattgccccccacttataaaca 3157403  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #69
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 557 - 639
Target Start/End: Original strand, 15797138 - 15797220
Alignment:
557 accagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggat 639  Q
    |||||||||||||| ||||||||||||| ||||||||||| ||| ||||||| ||||||| ||| | |||| |||||| ||||    
15797138 accagcactattgggcttggttcgtggacataaatggtggatgggccgatagaggaaacccgatggaaggtggcccaacggat 15797220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #70
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 661 - 739
Target Start/End: Original strand, 22638178 - 22638255
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||| |||||||||||| ||||||||||||||||||| || ||||| | ||||||||| |||| |||||||||||    
22638178 tcttagaaatcgtggttgggcttaacacaaccccacaaaaccggcttgtgtggtgaggattgcccct-acttataaaca 22638255  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #71
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 439 - 513
Target Start/End: Complemental strand, 27205049 - 27204975
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataa 513  Q
    |||||||| |||| ||||| | |||||||||||||||||||||| || |||| || |||||||||||||||||||    
27205049 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttatgaggtgaggattgcccccacttataa 27204975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #72
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 439 - 513
Target Start/End: Complemental strand, 27205147 - 27205073
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataa 513  Q
    |||||||| |||| ||||| | |||||||||||||||||||||| || |||| || |||||||||||||||||||    
27205147 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttatgaggtgaggattgcccccacttataa 27205073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #73
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 439 - 513
Target Start/End: Complemental strand, 27205245 - 27205171
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataa 513  Q
    |||||||| |||| ||||| | |||||||||||||||||||||| || |||| || |||||||||||||||||||    
27205245 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttatgaggtgaggattgcccccacttataa 27205171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #74
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 662 - 739
Target Start/End: Complemental strand, 8929101 - 8929025
Alignment:
662 cttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    ||||||| |||||||||||||||||||||||||||||||| || ||||||| || |||||| ||| || |||||||||    
8929101 cttagaattcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgcggattg-cccccagttataaaca 8929025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #75
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 439 - 516
Target Start/End: Original strand, 11232193 - 11232270
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| | || ||||| | |||||||||||||||||||||| |||| || || ||||||||||||||||||||||    
11232193 tcttagaaatggtggttgggcctaacacaaccccacaaaaccggcttgtaaggtgaggattgcccccacttataaaca 11232270  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #76
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 439 - 516
Target Start/End: Original strand, 11232428 - 11232505
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| | || ||||| | |||||||||||||||||||||| |||| || || ||||||||||||||||||||||    
11232428 tcttagaaatggtggttgggcctaacacaaccccacaaaaccggcttgtaaggtgaggattgcccccacttataaaca 11232505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #77
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 439 - 516
Target Start/End: Original strand, 24532420 - 24532497
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| || | ||||| | |||||||||||||||||||||| ||||||| ||  |||||||||||||||||||||    
24532420 tcttagaaatcatggttgggcctaacacaaccccacaaaaccggcttgtgaggtgatgattgcccccacttataaaca 24532497  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #78
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 439 - 516
Target Start/End: Complemental strand, 37001549 - 37001472
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| |||| ||||| | |||||||||||||||||||||| ||||||  || |||||| |||||||||||||||    
37001549 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgatgtgaggattgtccccacttataaaca 37001472  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #79
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 439 - 516
Target Start/End: Complemental strand, 38475832 - 38475755
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| | || ||||| | ||||||||||| |||||||||| ||||||| || ||||||||||||||||||||||    
38475832 tcttagaatttgtggttgggcctaacacaaccctacaaaaccggcttgtgaggtgaggattgcccccacttataaaca 38475755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #80
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 459 - 516
Target Start/End: Complemental strand, 39984879 - 39984822
Alignment:
459 cttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    ||||||||||||||||||||| || ||||||| || ||||||||||||||||||||||    
39984879 cttaacacaaccccacaaaactggcttgtgaggtgaggattgcccccacttataaaca 39984822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #81
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 448 - 516
Target Start/End: Complemental strand, 4828144 - 4828076
Alignment:
448 tcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||| ||||| | |||||||||||||||||||||| ||||||| || |||||| |||||||||||||||    
4828144 tcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgtccccacttataaaca 4828076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #82
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 663 - 739
Target Start/End: Complemental strand, 39743612 - 39743537
Alignment:
663 ttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||| |||||||||||||||||||||||||||||||  || ||||||| ||||||||| |||  |||||||||||    
39743612 ttagaaatcgtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgaggattg-ccccaacttataaaca 39743537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #83
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 663 - 722
Target Start/End: Original strand, 422218 - 422277
Alignment:
663 ttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattg 722  Q
    |||||| |||||||| ||||||||| |||||||||||||||| ||||||| |||||||||    
422218 ttagaaatcgtggtttggcctaacataaccccacaaaactggcttgtgaggtgaggattg 422277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #84
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 672 - 739
Target Start/End: Original strand, 5931959 - 5932025
Alignment:
672 gtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||||||||||| ||||||||||||| || ||||||| ||||||||| ||| ||||||||||||    
5931959 gtggttgggcctaacataaccccacaaaaccggcttgtgaggtgaggattg-cccccacttataaaca 5932025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #85
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 461 - 516
Target Start/End: Original strand, 5931970 - 5932025
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    ||||| |||||||||||||||| ||||||| || ||||||||||||||||||||||    
5931970 taacataaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaaca 5932025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #86
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 439 - 514
Target Start/End: Complemental strand, 12547183 - 12547109
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaa 514  Q
    |||||||| |||||||||| | |||||||||||||||||||||| ||||||| ||  ||||| |||||||||||||    
12547183 tcttagaaatcgtagttgggcctaacacaaccccacaaaaccggcttgtgaggtgaagattg-ccccacttataaa 12547109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #87
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 660 - 739
Target Start/End: Complemental strand, 12688393 - 12688315
Alignment:
660 atcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    ||||||||| || ||||||| |||| ||||||||||||||||||| ||||||| | ||||||| ||| ||||||||||||    
12688393 atcttagaaatcatggttggacctatcacaaccccacaaaactggcttgtgaggtaaggattg-cccccacttataaaca 12688315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #88
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 461 - 516
Target Start/End: Complemental strand, 34843180 - 34843125
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||||||||||||||||| ||||||| || ||||||| ||||||||||||||    
34843180 taacacaaccccacaaaaccggcttgtgaggtgaggattgctcccacttataaaca 34843125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #89
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 661 - 740
Target Start/End: Original strand, 35385810 - 35385889
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaacat 740  Q
    |||||||| | ||||||| || ||||||||||||||||||| || || |||| ||||||||| ||| |||||||||||||    
35385810 tcttagaaatggtggttgagcttaacacaaccccacaaaaccggcttatgaggtgaggattgccccccacttataaacat 35385889  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #90
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 441 - 516
Target Start/End: Complemental strand, 39743612 - 39743537
Alignment:
441 ttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||| |||| ||||| | |||||||||||||||||| ||| ||||||| || |||||||||| |||||||||||    
39743612 ttagaaatcgtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgaggattgccccaacttataaaca 39743537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #91
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 597 - 688
Target Start/End: Complemental strand, 42584819 - 42584728
Alignment:
597 gtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacac 688  Q
    |||||||||||  |||||| |||||||||||||||||| |||||||| | || ||| |||| | |||||||| | |||||| ||||||||||    
42584819 gtggcccgataaaggaaacatgatagcaggtagcccaacggatcttggataggctctgataccgtcttagaatttgtggttaggcctaacac 42584728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #92
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 661 - 739
Target Start/End: Complemental strand, 10450085 - 10450008
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||| ||||||||| |||||||||||||| ||||||| || || |||| ||||||||| ||| ||||||||||||    
10450085 tcttagaaatcgtggttgagcctaacacaaccctacaaaaccggcttctgaggtgaggattg-cccacacttataaaca 10450008  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #93
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 661 - 739
Target Start/End: Original strand, 15042669 - 15042746
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||| ||||||||| |||||||||||||||||||||  |||||| ||| ||| ||||| ||| ||||||||||||    
15042669 tcttagaaatcgtggttgagcctaacacaaccccacaaaatcggtttgcgaggtgatgattg-cccccacttataaaca 15042746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #94
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 661 - 739
Target Start/End: Complemental strand, 25325731 - 25325654
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||| |||||||||||||||| ||||| |||||||||||| |||||||  |||||||| | | ||||||||||||    
25325731 tcttagaaatcgtggttgggcctaaaacaactccacaaaactggcttgtgaggagaggattg-cacccacttataaaca 25325654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #95
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 677 - 739
Target Start/End: Original strand, 38447442 - 38447503
Alignment:
677 tgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    ||||||||||||||||||||||||| || ||||||| ||||||||| ||| ||||||||||||    
38447442 tgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattg-cccccacttataaaca 38447503  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #96
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 526 - 619
Target Start/End: Original strand, 5589839 - 5589932
Alignment:
526 cgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctga 619  Q
    ||||||||| | ||||| |||||   |||| || |||| |||||| ||||||||||||| |||||| |||||||  ||||||||||||||||||    
5589839 cgatgtgggcctcttaacacacccgttcacgactagcattattgggcttggttcgtggacataaattgtgggtgatccgatagcggaaacctga 5589932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #97
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 661 - 722
Target Start/End: Complemental strand, 12547183 - 12547122
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattg 722  Q
    |||||||| |||| ||||||||||||||||||||||||||| || ||||||| ||| |||||    
12547183 tcttagaaatcgtagttgggcctaacacaaccccacaaaaccggcttgtgaggtgaagattg 12547122  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #98
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 439 - 516
Target Start/End: Original strand, 15042669 - 15042746
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| |||| ||||  | |||||||||||||||||| ||||||| ||| ||  |||||||||||||||||||||    
15042669 tcttagaaatcgtggttgagcctaacacaaccccacaaaatcggtttgcgaggtgatgattgcccccacttataaaca 15042746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #99
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 439 - 516
Target Start/End: Original strand, 15042885 - 15042962
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| |||| ||| | | |||||||||||||||||||||||||  ||| |  ||||||||||||||||||||||    
15042885 tcttagaaatcgtggttaggcctaacacaaccccacaaaaccggtttacgaggtaaggattgcccccacttataaaca 15042962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #100
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 439 - 516
Target Start/End: Complemental strand, 20301346 - 20301269
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| |||| ||||| | |||||||||| |||||||| || ||||||| |  ||||||||||||||||||||||    
20301346 tcttagaaatcgtggttgggcctaacacaacctcacaaaacgggcttgtgaggttaggattgcccccacttataaaca 20301269  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #101
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 439 - 516
Target Start/End: Complemental strand, 21087978 - 21087901
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| |||| ||||| | |||||||||| |||||||| || ||||||| |  ||||||||||||||||||||||    
21087978 tcttagaaatcgtggttgggcctaacacaacctcacaaaacgggcttgtgaggttaggattgcccccacttataaaca 21087901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #102
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 441 - 514
Target Start/End: Original strand, 28069358 - 28069431
Alignment:
441 ttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaa 514  Q
    |||||| |||| ||||||  ||||||||| |||||||| | ||||||||| || ||||||||||||||||||||    
28069358 ttagaaatcgtggttggatctaacacaactccacaaaatcagtttgtgaggtgaggattgcccccacttataaa 28069431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #103
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 663 - 739
Target Start/End: Complemental strand, 34653233 - 34653159
Alignment:
663 ttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||| |||||||||||||||||||||||||||||||| || ||||||  | |||||  | |||||||||||||||    
34653233 ttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgatgttaggat--tacctcacttataaaca 34653159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #104
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 439 - 516
Target Start/End: Complemental strand, 37001311 - 37001234
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||| ||| |||| ||||| | ||||||||| |||||||||||| ||||||| || ||||||||||||| ||||||||    
37001311 tctttgaaatcgtggttgggcctaacacaactccacaaaaccggcttgtgaggtgaggattgcccccacctataaaca 37001234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #105
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 550 - 642
Target Start/End: Original strand, 7289323 - 7289415
Alignment:
550 cctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatctt 642  Q
    |||| ||| ||||||| ||  ||||||||| |||| |||||||||||||||   ||||||| |||||||||||||||| ||| |||| |||||    
7289323 cctctcaatcagcactgttaaacttggttcctggacataaatggtgggtggtttgatagcgaaaacctgatagcaggtggccaaatgaatctt 7289415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #106
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 453 - 517
Target Start/End: Original strand, 16962259 - 16962323
Alignment:
453 gttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaacat 517  Q
    ||||||| |||||||| ||||||||||||||||||||| || | ||||  |||||||||||||||    
16962259 gttggacctaacacaatcccacaaaaccggtttgtgaggtgagaattgttcccacttataaacat 16962323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #107
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 459 - 522
Target Start/End: Original strand, 35385830 - 35385894
Alignment:
459 cttaacacaaccccacaaaaccggtttgtgagatgtggattg-cccccacttataaacatcttat 522  Q
    |||||||||||||||||||||||| || |||| || |||||| ||||||||||||||||| ||||    
35385830 cttaacacaaccccacaaaaccggcttatgaggtgaggattgccccccacttataaacatattat 35385894  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #108
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 683 - 739
Target Start/End: Complemental strand, 39984877 - 39984822
Alignment:
683 taacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||||||||||||||||| ||||||| ||||||||| ||| ||||||||||||    
39984877 taacacaaccccacaaaactggcttgtgaggtgaggattg-cccccacttataaaca 39984822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #109
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 661 - 709
Target Start/End: Original strand, 44694708 - 44694756
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgt 709  Q
    |||||||| | ||||||||||||||||||||||||||||||||| ||||    
44694708 tcttagaatttgtggttgggcctaacacaaccccacaaaactggcttgt 44694756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #110
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 461 - 516
Target Start/End: Original strand, 5932205 - 5932260
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    ||||||||||||||||||| || ||||||| || || |||||||||||||||||||    
5932205 taacacaaccccacaaaacaggcttgtgaggtgaggcttgcccccacttataaaca 5932260  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #111
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 661 - 736
Target Start/End: Complemental strand, 6542000 - 6541925
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataa 736  Q
    |||||||| | | ||||||||||||||||| |||||||||| || ||||||| ||||||||  ||| |||||||||    
6542000 tcttagaatttgcggttgggcctaacacaaacccacaaaaccggcttgtgaggtgaggattaccccccacttataa 6541925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #112
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 461 - 516
Target Start/End: Original strand, 7267486 - 7267541
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    ||||||||||| |||||||||| ||||||| ||  |||||||||||||||||||||    
7267486 taacacaaccctacaaaaccggcttgtgaggtgatgattgcccccacttataaaca 7267541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #113
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 461 - 516
Target Start/End: Complemental strand, 7669482 - 7669427
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    ||||| |||||||||||||| |||||| |||||  |||||||||||||||||||||    
7669482 taacataaccccacaaaaccagtttgtaagatgatgattgcccccacttataaaca 7669427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #114
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 672 - 735
Target Start/End: Original strand, 26800522 - 26800584
Alignment:
672 gtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttata 735  Q
    |||||||||||||||||||||||||||||| || ||||| | ||||||||| ||| ||||||||    
26800522 gtggttgggcctaacacaaccccacaaaaccggcttgtgtggtgaggattg-cccccacttata 26800584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #115
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 461 - 512
Target Start/End: Original strand, 26800533 - 26800584
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttata 512  Q
    |||||||||||||||||||||| ||||| | || ||||||||||||||||||    
26800533 taacacaaccccacaaaaccggcttgtgtggtgaggattgcccccacttata 26800584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #116
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 562 - 609
Target Start/End: Complemental strand, 38475918 - 38475871
Alignment:
562 cactattggacttggttcgtggaaataaatggtgggtggcccgatagc 609  Q
    |||||||||||||||| |||||| ||||||||||||||||| ||||||    
38475918 cactattggacttggtgcgtggatataaatggtgggtggcctgatagc 38475871  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #117
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 461 - 516
Target Start/End: Complemental strand, 38476340 - 38476285
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||||||||||||| ||| ||||||| || ||||| ||||||||||||||||    
38476340 taacacaaccccacaaaatcggcttgtgaggtgaggatttcccccacttataaaca 38476285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #118
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 629 - 739
Target Start/End: Original strand, 5590335 - 5590444
Alignment:
629 gcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctc 728  Q
    ||||| ||||||||| | ||  || |||| ||| |||||| | ||||||||||||||||||||| |||||||| || ||||||  ||||||||| ||| |    
5590335 gcccagtggatcttggataggatctgataccattttagaaattgtggttgggcctaacacaacctcacaaaaccggcttgtgaagtgaggattg-ccccc 5590433  T
729 acttataaaca 739  Q
    |||| ||||||    
5590434 acttgtaaaca 5590444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #119
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 661 - 723
Target Start/End: Complemental strand, 10454511 - 10454449
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgt 723  Q
    |||||||| ||||||||| |||||||||||||| ||||||| || || |||| ||||||||||    
10454511 tcttagaaatcgtggttgagcctaacacaaccctacaaaaccggcttctgaggtgaggattgt 10454449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #120
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 439 - 516
Target Start/End: Complemental strand, 10884149 - 10884072
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgc-ccccacttataaaca 516  Q
    |||||||| |||| ||||| | ||||||||||| |||||||||| ||||||| || ||||||| |||||||||||||||    
10884149 tcttagaaatcgtggttgggcctaacacaaccc-acaaaaccggcttgtgaggtgaggattgccccccacttataaaca 10884072  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #121
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 661 - 739
Target Start/End: Original strand, 18939296 - 18939373
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||| | ||||||||||||||||||||| |||||||   | ||||||| ||||||||| ||| ||||||||||||    
18939296 tcttagaaatggtggttgggcctaacacaacctcacaaaatcagcttgtgaggtgaggattg-cccccacttataaaca 18939373  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #122
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 550 - 608
Target Start/End: Complemental strand, 29006052 - 29005994
Alignment:
550 cctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatag 608  Q
    |||||| |||||||||||||| ||| | || |||| |||||||||||||||||||||||    
29006052 cctcacgaccagcactattgggcttcgctcatggacataaatggtgggtggcccgatag 29005994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #123
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 661 - 739
Target Start/End: Complemental strand, 38476362 - 38476285
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||| | |||||| | ||||||||||||||||||||  || ||||||| |||||||| |||| ||||||||||||    
38476362 tcttagaatttgtggttagtcctaacacaaccccacaaaatcggcttgtgaggtgaggatt-tcccccacttataaaca 38476285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #124
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 663 - 712
Target Start/End: Complemental strand, 4963437 - 4963388
Alignment:
663 ttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgag 712  Q
    |||||| | |||||||||||||||||||||||||||||| || |||||||    
4963437 ttagaaattgtggttgggcctaacacaaccccacaaaaccggcttgtgag 4963388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #125
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 439 - 516
Target Start/End: Complemental strand, 10450085 - 10450008
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| |||| ||||  | ||||||||||| |||||||||| || |||| || ||||||||| ||||||||||||    
10450085 tcttagaaatcgtggttgagcctaacacaaccctacaaaaccggcttctgaggtgaggattgcccacacttataaaca 10450008  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #126
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 439 - 516
Target Start/End: Complemental strand, 12317131 - 12317054
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| |||| ||||| | |||||||| ||||||||| | | || |||| || ||||||||||||||||||||||    
12317131 tcttagaaatcgtggttgggcctaacacaatcccacaaaatcagcttatgaggtgaggattgcccccacttataaaca 12317054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #127
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 439 - 516
Target Start/End: Original strand, 18939296 - 18939373
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| | || ||||| | |||||||||| ||||||| | | ||||||| || ||||||||||||||||||||||    
18939296 tcttagaaatggtggttgggcctaacacaacctcacaaaatcagcttgtgaggtgaggattgcccccacttataaaca 18939373  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #128
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 682 - 739
Target Start/End: Complemental strand, 20702861 - 20702804
Alignment:
682 ctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    ||||||||||| |||||||| || || |||||||||||||| ||| ||||||||||||    
20702861 ctaacacaacctcacaaaaccggcttatgagatgaggattgccccccacttataaaca 20702804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #129
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 581 - 634
Target Start/End: Original strand, 29907865 - 29907918
Alignment:
581 tggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaa 634  Q
    |||| ||||||||||||||| |||||| || |||||||||||||||| ||||||    
29907865 tggacataaatggtgggtggaccgataacgaaaacctgatagcaggtggcccaa 29907918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #130
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 439 - 516
Target Start/End: Complemental strand, 41790743 - 41790667
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| |||| ||||| | ||||||||||| |||||||||| || |||| || |||||| |||||||||||||||    
41790743 tcttagaaatcgtggttgggcctaacacaaccc-acaaaaccggcttatgaggtgaggattgtccccacttataaaca 41790667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #131
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 439 - 516
Target Start/End: Original strand, 42049686 - 42049763
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| |||| ||| | | || ||||||| ||||||||||| ||||| | || ||||||||||||||||||||||    
42049686 tcttagaaatcgtggttaggcctaccacaacctcacaaaaccggcttgtggggtgaggattgcccccacttataaaca 42049763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #132
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 663 - 739
Target Start/End: Original strand, 7267466 - 7267541
Alignment:
663 ttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||| | ||||||||| |||||||||||| ||||||| || ||||||| ||| ||||| ||| ||||||||||||    
7267466 ttagaaatggtggttgggtctaacacaaccctacaaaaccggcttgtgaggtgatgattg-cccccacttataaaca 7267541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #133
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 539 - 700
Target Start/End: Complemental strand, 8849389 - 8849226
Alignment:
539 ttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtgg--cccgatagcggaaacctgatagcaggtagcccaatg 636  Q
    |||| ||||| |||||| |||| |||||||||  ||||||| | || |||||||| ||  ||  | ||| |||||||| ||||||| |||| || ||||     
8849389 ttaacacaccccctcacgaccaacactattgggtttggttcatagatataaatggcggaaggtacgcgacagcggaaaactgatagtaggtggctcaata 8849290  T
637 gatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaa 700  Q
     || |||| ||||||  ||||||||||||||| |||| ||||| | |||||||||  |||||||    
8849289 aattttgatgagactttgatatcatcttagaaatcgtagttggacgtaacacaacaacacaaaa 8849226  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #134
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 633 - 677
Target Start/End: Original strand, 8860814 - 8860858
Alignment:
633 aatggatcttgaagagactcagatatcatcttagaactcgtggtt 677  Q
    |||||||||||||||||||| ||||| ||||||||| ||||||||    
8860814 aatggatcttgaagagactctgatattatcttagaaatcgtggtt 8860858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #135
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 572 - 739
Target Start/End: Complemental strand, 10615805 - 10615638
Alignment:
572 cttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactc 671  Q
    |||||||| |||| | ||||||| | |||  |||||||| |||| ||||||||||| |   ||||||||||  ||||  ||  ||||||||||||||  |    
10615805 cttggttcatggacacaaatggtagatggttcgatagcgaaaacgtgatagcaggtggtttaatggatcttagagaggttctaatatcatcttagaaacc 10615706  T
672 gtggttgggcctaacacaa-ccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    ||||||| |||||| |||| ||||||||||| |  |||| ||  |||||||  ||||||||||||||||    
10615705 gtggttgagcctaatacaacccccacaaaaccgacttgtaaggagaggatt-accctcacttataaaca 10615638  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #136
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 660 - 740
Target Start/End: Original strand, 18004094 - 18004173
Alignment:
660 atcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaacat 740  Q
    ||||||||| || |||||||||||||||||||| |||||||| |  || || | ||||||||| ||| |||||||||||||    
18004094 atcttagaaatcttggttgggcctaacacaacctcacaaaaccgacttatggggtgaggattg-cccccacttataaacat 18004173  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #137
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 586 - 634
Target Start/End: Original strand, 19472408 - 19472456
Alignment:
586 ataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaa 634  Q
    |||||||  ||||||||||||||||||||||||||| ||||| ||||||    
19472408 ataaatgacgggtggcccgatagcggaaacctgataacaggtggcccaa 19472456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #138
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 586 - 634
Target Start/End: Original strand, 19543333 - 19543381
Alignment:
586 ataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaa 634  Q
    |||||||  ||||||||||||||||||||||||||| ||||| ||||||    
19543333 ataaatgacgggtggcccgatagcggaaacctgataacaggtggcccaa 19543381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #139
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 586 - 634
Target Start/End: Complemental strand, 19589363 - 19589315
Alignment:
586 ataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaa 634  Q
    |||||||  ||||||||||||||||||||||||||| ||||| ||||||    
19589363 ataaatgacgggtggcccgatagcggaaacctgataacaggtggcccaa 19589315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #140
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 465 - 517
Target Start/End: Original strand, 20094819 - 20094871
Alignment:
465 acaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaacat 517  Q
    |||||||||||||||||| |||| || || ||||||||||||| |||||||||    
20094819 acaaccccacaaaaccggcttgtaaggtgaggattgcccccacatataaacat 20094871  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #141
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 461 - 516
Target Start/End: Complemental strand, 20702860 - 20702804
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgc-ccccacttataaaca 516  Q
    |||||||||| ||||||||||| || ||||||| ||||||| |||||||||||||||    
20702860 taacacaacctcacaaaaccggcttatgagatgaggattgccccccacttataaaca 20702804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #142
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 661 - 701
Target Start/End: Original strand, 24532285 - 24532325
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaac 701  Q
    |||||||  ||||||||||||||||||||||||||||||||    
24532285 tcttagagatcgtggttgggcctaacacaaccccacaaaac 24532325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #143
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 632 - 692
Target Start/End: Complemental strand, 29005978 - 29005918
Alignment:
632 caatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaacc 692  Q
    ||||||||||||| |||||||  ||| | |||||||| ||||||||||| |||||||||||    
29005978 caatggatcttgaggagactctaataccgtcttagaaatcgtggttgggtctaacacaacc 29005918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #144
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 550 - 614
Target Start/End: Original strand, 37868196 - 37868260
Alignment:
550 cctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaa 614  Q
    |||||| |||| ||||||||| ||||| ||||||| |||||||||||||| ||| ||||| ||||    
37868196 cctcacgaccaacactattgggcttggctcgtggacataaatggtgggtgacccaatagcagaaa 37868260  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #145
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 461 - 516
Target Start/End: Original strand, 5590389 - 5590444
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||||| ||||||||||| ||||||  || ||||||||||||||| ||||||    
5590389 taacacaacctcacaaaaccggcttgtgaagtgaggattgcccccacttgtaaaca 5590444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #146
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 462 - 517
Target Start/End: Original strand, 6559471 - 6559526
Alignment:
462 aacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaacat 517  Q
    |||| |||| ||||||||||| |||| || || |||||||||||||||||||||||    
6559471 aacataacctcacaaaaccggcttgtaaggtgaggattgcccccacttataaacat 6559526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #147
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 473 - 516
Target Start/End: Complemental strand, 7729992 - 7729949
Alignment:
473 acaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||||| ||||||| || ||||||||||||||||||||||    
7729992 acaaaaccggcttgtgaggtgaggattgcccccacttataaaca 7729949  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #148
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 659 - 722
Target Start/End: Original strand, 10615153 - 10615216
Alignment:
659 catcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattg 722  Q
    |||||||||| | |||||||||| |||| ||||||||||||||| | |||| || |||||||||    
10615153 catcttagaaattgtggttgggcttaacgcaaccccacaaaactagcttgttaggtgaggattg 10615216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #149
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 461 - 516
Target Start/End: Complemental strand, 34842741 - 34842686
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||||||||||||||||   | |||| || ||||||||||||||||||||||    
34842741 taacacaaccccacaaaaccgacctatgaggtgaggattgcccccacttataaaca 34842686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #150
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 562 - 609
Target Start/End: Complemental strand, 38476021 - 38475974
Alignment:
562 cactattggacttggttcgtggaaataaatggtgggtggcccgatagc 609  Q
    |||||||||||||||| | |||| ||||||||||||||||| ||||||    
38476021 cactattggacttggtgcatggatataaatggtgggtggcctgatagc 38475974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #151
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 673 - 724
Target Start/End: Complemental strand, 45122418 - 45122367
Alignment:
673 tggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtc 724  Q
    |||||||||||||||||||||||| |||| || |||| || |||||||||||    
45122418 tggttgggcctaacacaaccccacgaaaccggcttgtaaggtgaggattgtc 45122367  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #152
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 661 - 739
Target Start/End: Original strand, 3157008 - 3157085
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||| | ||| ||| ||||||||||||||||||||||    ||||||| ||||||||| ||| ||||||||||||    
3157008 tcttagaaatggtgattgagcctaacacaaccccacaaaac-atcttgtgaggtgaggattgccccccacttataaaca 3157085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #153
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 461 - 514
Target Start/End: Original strand, 3157580 - 3157634
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattg-cccccacttataaa 514  Q
    ||||||||||||||||||| || ||||||| || |||||| ||||||||||||||    
3157580 taacacaaccccacaaaactggcttgtgaggtgaggattgccccccacttataaa 3157634  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #154
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 588 - 686
Target Start/End: Original strand, 9397800 - 9397898
Alignment:
588 aaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaac 686  Q
    ||||||| ||||||| ||||| | |||||||||| ||| | | |||| |||||||  |||||||| || |||||||||||| | | |||||| ||||||    
9397800 aaatggttggtggcctgatagtgaaaacctgatatcagatggtccaacggatcttagagagactctgaaatcatcttagaaattgcggttggtcctaac 9397898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #155
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 586 - 668
Target Start/End: Complemental strand, 17476991 - 17476909
Alignment:
586 ataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaa 668  Q
    |||||||  ||||||||||||| ||||||||||||| ||||| ||||||   ||| ||||||| ||| |||| ||| ||||||    
17476991 ataaatgacgggtggcccgataacggaaacctgataacaggtggcccaaacaatcgtgaagaggctctgataccatattagaa 17476909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #156
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 439 - 517
Target Start/End: Original strand, 18004095 - 18004173
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaacat 517  Q
    |||||||| || | ||||| | |||||||||| ||||||||||  || || | || |||||||||||||||||||||||    
18004095 tcttagaaatcttggttgggcctaacacaacctcacaaaaccgacttatggggtgaggattgcccccacttataaacat 18004173  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #157
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 532 - 609
Target Start/End: Original strand, 28213208 - 28213283
Alignment:
532 gggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagc 609  Q
    ||||| ||||| |||||||||||  || | ||||||||| |||| |||||||| |||||||  |||||||||||||||    
28213208 gggactcttaacacaccacctcatgactaacactattgggcttgattcgtggacataaatg--gggtggcccgatagc 28213283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #158
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 450 - 516
Target Start/End: Original strand, 29099750 - 29099816
Alignment:
450 gtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||| ||| |||||| ||||||||||| | ||||||||| ||  ||||||| |||||||||||||    
29099750 gtagttagacctaacactaccccacaaaatcagtttgtgaggtgaagattgcctccacttataaaca 29099816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #159
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 586 - 648
Target Start/End: Complemental strand, 34843010 - 34842948
Alignment:
586 ataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagag 648  Q
    ||||||| |||||||||||||| || |||||||||| ||||| |||||| | ||| |||||||    
34843010 ataaatgatgggtggcccgataacgaaaacctgataacaggtggcccaaagaatcgtgaagag 34842948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #160
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 586 - 668
Target Start/End: Complemental strand, 39743455 - 39743373
Alignment:
586 ataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaa 668  Q
    |||||||  ||||||||||||| ||||||||||||| ||||| ||||||   ||| ||||||| ||| |||| ||| ||||||    
39743455 ataaatgacgggtggcccgataacggaaacctgataacaggtggcccaaacaatcgtgaagaggctctgataccatattagaa 39743373  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #161
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 463 - 516
Target Start/End: Original strand, 8466747 - 8466800
Alignment:
463 acacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    ||||||||||| |||||| | ||||||| || |||||| |||||||||||||||    
8466747 acacaaccccataaaaccagcttgtgaggtgaggattgtccccacttataaaca 8466800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #162
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 526 - 582
Target Start/End: Original strand, 10615038 - 10615095
Alignment:
526 cgatgtgggacgctt-aatacaccacctcacaaccagcactattggacttggttcgtg 582  Q
    ||||||||||| ||| || ||||  ||||||||||| |||||||||||||||||||||    
10615038 cgatgtgggactctttaacacacaccctcacaaccaacactattggacttggttcgtg 10615095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #163
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 467 - 516
Target Start/End: Complemental strand, 20515201 - 20515152
Alignment:
467 aaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||||||||||| ||||||  || |||||||||| |||||||||||    
20515201 aaccccacaaaaccggcttgtgatgtgaggattgccccgacttataaaca 20515152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #164
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 439 - 516
Target Start/End: Complemental strand, 25325731 - 25325654
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| |||| ||||| | ||| ||||| ||||||||| || |||||||  | ||||||| ||||||||||||||    
25325731 tcttagaaatcgtggttgggcctaaaacaactccacaaaactggcttgtgaggagaggattgcacccacttataaaca 25325654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #165
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 682 - 739
Target Start/End: Complemental strand, 34843181 - 34843125
Alignment:
682 ctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||||||||||||||| || ||||||| ||||||||| | | ||||||||||||    
34843181 ctaacacaaccccacaaaaccggcttgtgaggtgaggattg-ctcccacttataaaca 34843125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #166
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 672 - 709
Target Start/End: Original strand, 36907438 - 36907475
Alignment:
672 gtggttgggcctaacacaaccccacaaaactggtttgt 709  Q
    ||||||||||||||||||||||||| ||||||| ||||    
36907438 gtggttgggcctaacacaaccccaccaaactggcttgt 36907475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 126; Significance: 2e-64; HSPs: 137)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 126; E-Value: 2e-64
Query Start/End: Original strand, 526 - 739
Target Start/End: Complemental strand, 4155544 - 4155332
Alignment:
526 cgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcag 625  Q
    ||||||||||| ||||| |||||  ||||| |||||||||||||| |||||||||| || ||||| ||||||||||||||||||||||||||||||||||    
4155544 cgatgtgggactcttaacacaccctctcacgaccagcactattgggcttggttcgtcgacataaacggtgggtggcccgatagcggaaacctgatagcag 4155445  T
626 gtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtcc 725  Q
    || |||||||| |||||| |||||||| |||| |||||||||| |||||||||||||||||||||||||||||||| || || |||| ||||||||| ||    
4155444 gtggcccaatgaatcttggagagactctgataccatcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttttgaggtgaggattg-cc 4155346  T
726 ctcacttataaaca 739  Q
    | ||||||||||||    
4155345 cccacttataaaca 4155332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 122; E-Value: 4e-62
Query Start/End: Original strand, 439 - 739
Target Start/End: Original strand, 35038193 - 35038504
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaacatcttat-------------att 525  Q
    |||||||| |||| ||||| | |||||||||||||||||||||| ||||||| || ||||| ||||||||||||||||  || |             ||     
35038193 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggatttcccccacttataaacacattgtcaggccatcacctatc 35038292  T
526 cgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcag 625  Q
    ||||||||||| ||||| ||||| |||||| ||||| |||||||| ||||||||||||| ||||||||||||||||| ||||||||||||||||| ||||    
35038293 cgatgtgggactcttaacacaccccctcacgaccagtactattgggcttggttcgtggacataaatggtgggtggcc-gatagcggaaacctgattgcag 35038391  T
626 gtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtcc 725  Q
    || ||||||||||||||| |||| | | |||| |||||||||| ||||||||||||||||||||||||||||||||  | |||| || ||||||||| ||    
35038392 gtggcccaatggatcttggagaggcactgataccatcttagaagtcgtggttgggcctaacacaaccccacaaaaccagcttgtcaggtgaggattg-cc 35038490  T
726 ctcacttataaaca 739  Q
    | ||||||||||||    
35038491 cccacttataaaca 35038504  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 113; E-Value: 9e-57
Query Start/End: Original strand, 448 - 739
Target Start/End: Original strand, 20327622 - 20327925
Alignment:
448 tcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaa-------------catcttatattcgatgtggg 534  Q
    |||| ||||| | |||||||||||||||||||||| ||||||| || ||||||||||||||||||||             ||| |  ||| |||||||||    
20327622 tcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaatacattgtcaggccatgtcctatccgatgtggg 20327721  T
535 acgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaa 634  Q
    |  ||||| |||||  ||||| |||| ||||||||| |||||||| |||| |||||||||||||||||||||||||||||||||||||||||| ||||||    
20327722 attcttaacacacccgctcacgaccaacactattgggcttggttcctggacataaatggtgggtggcccgatagcggaaacctgatagcaggtggcccaa 20327821  T
635 tggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttat 734  Q
    ||||| ||  |||| | | |||| ||| |||||| || ||||||||||||||||||||||||||||| || ||||||| ||||||||| ||| |||||||    
20327822 tggattttagagaggcactgataccatattagaaatcatggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattg-cccccacttat 20327920  T
735 aaaca 739  Q
    |||||    
20327921 aaaca 20327925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 100; E-Value: 5e-49
Query Start/End: Original strand, 526 - 739
Target Start/End: Original strand, 13574783 - 13574997
Alignment:
526 cgatgtgggacgctt-aatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagca 624  Q
    ||||||||||| ||| || ||||  |||||| || ||||||||||| ||||||||||||| |||||||||||||| | ||||||||||||||||||||||    
13574783 cgatgtgggactctttaacacactccctcacgactagcactattgggcttggttcgtggacataaatggtgggtgacacgatagcggaaacctgatagca 13574882  T
625 ggtagcccaatggatcttga-agagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgt 723  Q
    ||| |||||||||||||| |  ||| ||  |||| ||| |||||| | ||||||||||||||||||||||||||||||||| ||||||| |||||||| |    
13574883 ggtggcccaatggatcttaactgaggctttgataccatattagaaattgtggttgggcctaacacaaccccacaaaactggcttgtgaggtgaggatt-t 13574981  T
724 ccctcacttataaaca 739  Q
    ||| ||||||||||||    
13574982 cccccacttataaaca 13574997  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 95; E-Value: 5e-46
Query Start/End: Original strand, 538 - 739
Target Start/End: Complemental strand, 16239800 - 16239599
Alignment:
538 cttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatgg 637  Q
    ||||| ||||| |||||| |||| ||||||||  ||||||||||||| |||||||||||||||| ||||| ||||||||||||||||||| ||| || ||    
16239800 cttaacacaccccctcacgaccatcactattgagcttggttcgtggacataaatggtgggtggctcgataacggaaacctgatagcaggtggccaaacgg 16239701  T
638 atctt-gaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataa 736  Q
    ||||| || ||| ||| |||| |||||||||| ||||||||||||||||||||| |||||||||| || ||||||| ||||| ||| ||| |||||||||    
16239700 atcttggaggaggctctgataccatcttagaaatcgtggttgggcctaacacaatcccacaaaaccggcttgtgaggtgaggtttg-cccccacttataa 16239602  T
737 aca 739  Q
    |||    
16239601 aca 16239599  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 90; E-Value: 5e-43
Query Start/End: Original strand, 526 - 722
Target Start/End: Complemental strand, 34992826 - 34992636
Alignment:
526 cgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcag 625  Q
    ||||||||||| ||||| ||||| |||||| |||||||||||||| ||||||||||||| |||||||||||||| ||||| |||||||||||||||||||    
34992826 cgatgtgggactcttaacacaccccctcacgaccagcactattgggcttggttcgtggacataaatggtgggtgacccgacagcggaaacctgatagcag 34992727  T
626 gtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattg 722  Q
    || |||||||||| |||| |||||||| |||| ||||||| ||       | ||||||||| || || |||||||| || |||||||||||||||||    
34992726 gtggcccaatggaccttggagagactctgataccatcttaaaa------ttggggcctaactcatccgcacaaaaccggcttgtgagatgaggattg 34992636  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 89; E-Value: 2e-42
Query Start/End: Original strand, 557 - 713
Target Start/End: Original strand, 20303280 - 20303436
Alignment:
557 accagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagat 656  Q
    |||| ||||||||||||||||||||||| ||||||||||||||| ||||||| |||||||||||||||||| ||||||||||| ||  |||| ||| |||    
20303280 accaacactattggacttggttcgtggacataaatggtgggtggaccgatagtggaaacctgatagcaggtggcccaatggattttagagaggctctgat 20303379  T
657 atcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgaga 713  Q
    | ||| |||||| | |||||||| ||||||||||||||||||||| || ||||||||    
20303380 accatattagaaattgtggttggacctaacacaaccccacaaaaccggcttgtgaga 20303436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 82; E-Value: 3e-38
Query Start/End: Original strand, 606 - 739
Target Start/End: Complemental strand, 54568032 - 54567900
Alignment:
606 tagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggt 705  Q
    |||||||||||||||||||||| || |||||||||||| |||| ||| |||| |||||||||| |||||||||||||||||||||||||||||||| ||     
54568032 tagcggaaacctgatagcaggtggctcaatggatcttggagaggctctgataccatcttagaaatcgtggttgggcctaacacaaccccacaaaaccggc 54567933  T
706 ttgtgagatgaggattgtccctcacttataaaca 739  Q
    ||||||| |||||||| |||| ||||||||||||    
54567932 ttgtgaggtgaggatt-tcccccacttataaaca 54567900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 81; E-Value: 1e-37
Query Start/End: Original strand, 526 - 739
Target Start/End: Complemental strand, 31317451 - 31317237
Alignment:
526 cgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcag 625  Q
    |||||| |||| ||||| ||||| |||||| |||||||||||||   |||||||||||| |||||||||||||||||||||| |  ||||||||||| ||    
31317451 cgatgtaggactcttaacacaccccctcacgaccagcactattgagtttggttcgtggacataaatggtgggtggcccgataac-aaaacctgatagtag 31317353  T
626 gtagcccaatggatctt-gaagagactcagat---atcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggatt 721  Q
    || | |||| ||||||| |||||||||| |||   | |||||||||| ||||||||| ||||||||||| |||||||||| || ||||||| ||||||||    
31317352 gtggtccaacggatcttggaagagactctgataccaccatcttagaaatcgtggttgagcctaacacaatcccacaaaaccggcttgtgaggtgaggatt 31317253  T
722 gtccctcacttataaaca 739  Q
    |  || ||||||||||||    
31317252 g--ccccacttataaaca 31317237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 81; E-Value: 1e-37
Query Start/End: Original strand, 580 - 740
Target Start/End: Complemental strand, 45828185 - 45828026
Alignment:
580 gtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgg 679  Q
    ||||| |||||||||||||||| |||||||||||||||| |||||||| || |||||||||||| |||| ||| |||| |||||||||| | ||||| ||    
45828185 gtggacataaatggtgggtggctcgatagcggaaacctggtagcaggtggcgcaatggatcttggagaggctctgataccatcttagaaattgtggtagg 45828086  T
680 gcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaacat 740  Q
    ||||||||||||| |||||||| || ||||||| ||||||||| |||  ||||||||||||    
45828085 gcctaacacaacctcacaaaaccggcttgtgaggtgaggattg-ccccaacttataaacat 45828026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 80; E-Value: 4e-37
Query Start/End: Original strand, 461 - 639
Target Start/End: Original strand, 20303085 - 20303276
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaa-------------catcttatattcgatgtgggacgcttaatacac 547  Q
    |||||||| ||||||||||||||||||||| || ||||||||||||||||||||             ||| | |||| ||||||||||  ||||| ||||    
20303085 taacacaatcccacaaaaccggtttgtgaggtgaggattgcccccacttataaatacattgtcaggccatgtcatatccgatgtgggattcttaacacac 20303184  T
548 cacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggat 639  Q
    |  ||||| ||||||||| |||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||  ||||||||||    
20303185 ccgctcacgaccagcactgttggacttggttcgtggacataaatggtgggtggaccgatagcggaaacctgatagcaggtgacccaatggat 20303276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 78; E-Value: 7e-36
Query Start/End: Original strand, 586 - 739
Target Start/End: Original strand, 1723000 - 1723152
Alignment:
586 ataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaa 685  Q
    |||||||  ||||||||||||| ||||||||||||| ||||| ||||||   ||| ||||||| ||| |||| |||||||||| ||||||||||||||||    
1723000 ataaatgacgggtggcccgataacggaaacctgataacaggtggcccaaacaatcgtgaagaggctctgataccatcttagaaatcgtggttgggcctaa 1723099  T
686 cacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||||||||||| || ||||||| ||||||||| ||| ||||||||||||    
1723100 cacaaccccacaaaaccggcttgtgaggtgaggattg-cccccacttataaaca 1723152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 70; E-Value: 4e-31
Query Start/End: Original strand, 586 - 739
Target Start/End: Complemental strand, 11589945 - 11589793
Alignment:
586 ataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaa 685  Q
    ||||||||  |||| ||| ||| ||||||||||||| ||||| |||||| | ||| ||||||| ||| |||| ||| |||||| ||||||||||||||||    
11589945 ataaatggcaggtgacccaataacggaaacctgataacaggtggcccaaagaatcgtgaagaggctctgataccatattagaaatcgtggttgggcctaa 11589846  T
686 cacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||||||||||| || ||||||| ||||||||| ||| ||||||||||||    
11589845 cacaaccccacaaaaccggcttgtgaggtgaggattg-cccccacttataaaca 11589793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 70; E-Value: 4e-31
Query Start/End: Original strand, 614 - 739
Target Start/End: Original strand, 16926901 - 16927025
Alignment:
614 acctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgaga 713  Q
    |||||||| |||||  ||||||||||||||||||||||| |||| |||||||||| ||||||||| || ||||||||||||||||||| || ||||||||    
16926901 acctgataacaggtgacccaatggatcttgaagagactctgataccatcttagaaatcgtggttgagcttaacacaaccccacaaaaccggcttgtgaga 16927000  T
714 tgaggattgtccctcacttataaaca 739  Q
    ||||||||  ||| ||||||||||||    
16927001 tgaggatt-acccccacttataaaca 16927025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 68; E-Value: 6e-30
Query Start/End: Original strand, 565 - 700
Target Start/End: Original strand, 26272227 - 26272362
Alignment:
565 tattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatctt 664  Q
    |||||||||||||||||||  ||||||||||||| |  ||||||| ||||||||| ||||| | ||||||||||| |||||||  ||  |||||||||||    
26272227 tattggacttggttcgtgggcataaatggtgggttgaacgatagcagaaacctgaaagcagatggcccaatggatattgaagatgctttgatatcatctt 26272326  T
665 agaactcgtggttgggcctaacacaaccccacaaaa 700  Q
    |||| | ||||||||| |||||||||||||||||||    
26272327 agaaattgtggttgggtctaacacaaccccacaaaa 26272362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 527 - 657
Target Start/End: Original strand, 19954318 - 19954447
Alignment:
527 gatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcagg 626  Q
    |||||||||| ||||| || || |||||| ||||| |||||||| ||||||||||||| ||||||||||||||| | ||||||| ||||||||||||||     
19954318 gatgtgggactcttaacacccc-cctcacgaccagtactattgggcttggttcgtggacataaatggtgggtggtcagatagcgaaaacctgatagcaga 19954416  T
627 tagcccaatggatcttgaagagactcagata 657  Q
    | |||||||||||||||||||| ||| ||||    
19954417 tggcccaatggatcttgaagaggctctgata 19954447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 65; E-Value: 4e-28
Query Start/End: Original strand, 552 - 739
Target Start/End: Complemental strand, 49629800 - 49629613
Alignment:
552 tcacaaccagcactattggacttggttcgtggaaataaatggtgggtggc-ccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagac 650  Q
    |||| |||| ||||||||| |||||||  |||| ||||||||||||  || |||||||| ||||||||||||||||| | |||||||||||||||||| |    
49629800 tcacgaccaacactattgggcttggtttatggacataaatggtgggatgctccgatagcagaaacctgatagcaggtggtccaatggatcttgaagaggc 49629701  T
651 tcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    ||  ||| ||| ||| || | ||  ||||| |||||||||||||||||||| |||||||||| || |||||| ||  ||||||||||||    
49629700 tctaataccattttaaaaatggtaattgggtctaacacaaccccacaaaaccggtttgtgaggtggggattg-ccgccacttataaaca 49629613  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 63; E-Value: 6e-27
Query Start/End: Original strand, 629 - 739
Target Start/End: Complemental strand, 54368633 - 54368524
Alignment:
629 gcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctc 728  Q
    |||||||||||||||||||| ||| |||| |||||||||| ||||||||||| |||||||||||||| ||||| || ||||||| ||||||||| ||| |    
54368633 gcccaatggatcttgaagaggctctgataccatcttagaaatcgtggttgggtctaacacaaccccataaaaccggcttgtgaggtgaggattg-ccccc 54368535  T
729 acttataaaca 739  Q
    |||||||||||    
54368534 acttataaaca 54368524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 58; E-Value: 6e-24
Query Start/End: Original strand, 572 - 701
Target Start/End: Original strand, 8142557 - 8142686
Alignment:
572 cttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactc 671  Q
    ||||||||||||| ||||||||||||||| | ||| | ||||| |||||||||| |  || ||||||| || ||||| ||| |||| |||||||||| ||    
8142557 cttggttcgtggacataaatggtgggtggtctgattgaggaaatctgatagcagatgacctaatggattttaaagaggctctgataccatcttagaaatc 8142656  T
672 gtggttgggcctaacacaaccccacaaaac 701  Q
    |||||| | |||||||||||||||||||||    
8142657 gtggttagacctaacacaaccccacaaaac 8142686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 538 - 701
Target Start/End: Original strand, 26753397 - 26753560
Alignment:
538 cttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatgg 637  Q
    ||||| ||||| |||||||| |||||| |||||  |||||||||| | ||||| || ||||| |||||||| | || |||||||||||||   ||||||     
26753397 cttaacacaccccctcacaagcagcacaattgggtttggttcgtgaacataaacggcgggtgccccgatagtgaaatcctgatagcaggtgatccaatga 26753496  T
638 atcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaac 701  Q
    ||||||||||  ||| ||||| ||||||||| ||||||||||| |||| ||||  |||||||||    
26753497 atcttgaagatgctcggatattatcttagaaatcgtggttgggtctaatacaattccacaaaac 26753560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 55; E-Value: 4e-22
Query Start/End: Original strand, 526 - 620
Target Start/End: Original strand, 39683367 - 39683461
Alignment:
526 cgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgat 620  Q
    ||||||||||| ||||| |||   |||||| ||||||| |||||| ||||||||||||| |||||||||||||||||||||||| ||||||||||    
39683367 cgatgtgggactcttaacacagtccctcacgaccagcattattgggcttggttcgtggacataaatggtgggtggcccgatagcagaaacctgat 39683461  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 55; E-Value: 4e-22
Query Start/End: Original strand, 562 - 648
Target Start/End: Complemental strand, 46139446 - 46139360
Alignment:
562 cactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagag 648  Q
    ||||||||| ||||||| ||| | |||||||||||||||||||||||| |||||||||||||||||  |||||||||||||| ||||    
46139446 cactattgggcttggtttgtgaacataaatggtgggtggcccgatagcagaaacctgatagcaggtgacccaatggatcttggagag 46139360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 544 - 668
Target Start/End: Original strand, 22775516 - 22775641
Alignment:
544 acaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttg 643  Q
    |||||||||||   ||| |||||||||  ||||| | |||| |||||||||||||||||||||||| ||||||| ||||||||| ||||||| |||||||    
22775516 acaccacctcatgcccaacactattgggattggtgcatggatataaatggtgggtggcccgatagcagaaacctaatagcaggtggcccaatagatcttg 22775615  T
644 aa-gagactcagatatcatcttagaa 668  Q
    || ||| ||| |||| ||||||||||    
22775616 aaggaggctctgataccatcttagaa 22775641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 545 - 661
Target Start/End: Complemental strand, 39269275 - 39269159
Alignment:
545 caccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttga 644  Q
    ||||||||||| |||| ||||||| |  |||||||||||| ||||||||||||||| |||||| |||  |||||||||||||| |||||||||||| ||     
39269275 caccacctcacgaccaacactattagggttggttcgtggacataaatggtgggtggtccgataacggccacctgatagcaggtggcccaatggatcatgg 39269176  T
645 agagactcagatatcat 661  Q
    |||| | | ||||||||    
39269175 agaggccctgatatcat 39269159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 596 - 726
Target Start/End: Original strand, 12930061 - 12930192
Alignment:
596 ggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaag-agactcagatatcatcttagaactcgtggttgggcctaacacaacccc 694  Q
    ||||||| |||| | ||||||||||||||||| |||||| ||||| || || || ||  |||| |||||||||| | |||||||||||||||||||||||    
12930061 ggtggcctgataacagaaacctgatagcaggtggcccaacggatcatggaggaggctttgataccatcttagaaatggtggttgggcctaacacaacccc 12930160  T
695 acaaaactggtttgtgagatgaggattgtccc 726  Q
    ||||||| || ||||||  |||| ||||||||    
12930161 acaaaaccggcttgtgaagtgagaattgtccc 12930192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 516 - 658
Target Start/End: Original strand, 52724075 - 52724217
Alignment:
516 atcttatattcgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaac 615  Q
    ||||| ||| ||||||||||| ||||| ||||| | |||| | || |||||| |   ||||||| |||| ||||||||||||||||||||||||| ||||    
52724075 atcttctatccgatgtgggactcttaacacacctcttcacgatcaacactatcgagtttggttcatggacataaatggtgggtggcccgatagcgaaaac 52724174  T
616 ctgatagcaggtagcccaatggatcttgaagagactcagatat 658  Q
    ||||||||| ||  ||||||| || |||||||| ||| |||||    
52724175 ctgatagcatgtgacccaatgaatgttgaagaggctctgatat 52724217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 439 - 516
Target Start/End: Original strand, 1723075 - 1723152
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| |||| ||||| | |||||||||||||||||||||| ||||||| || ||||||||||||||||||||||    
1723075 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaaca 1723152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 439 - 516
Target Start/End: Original strand, 16926948 - 16927025
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| |||| ||||  |||||||||||||||||||||||| |||||||||| ||||| ||||||||||||||||    
16926948 tcttagaaatcgtggttgagcttaacacaaccccacaaaaccggcttgtgagatgaggattacccccacttataaaca 16927025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 596 - 721
Target Start/End: Original strand, 28087149 - 28087274
Alignment:
596 ggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaacccca 695  Q
    |||||||||||| ||||||||||||| ||||| |||||| | ||| ||||||| ||| | || |||||||||| ||||| ||||| || |||||| ||||    
28087149 ggtggcccgataacggaaacctgataacaggtggcccaaagaatcgtgaagaggctctggtaccatcttagaaatcgtgattgggtctgacacaatccca 28087248  T
696 caaaactggtttgtgagatgaggatt 721  Q
    |||||| || ||||||| ||| ||||    
28087249 caaaaccggcttgtgaggtgatgatt 28087274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 572 - 720
Target Start/End: Original strand, 37246763 - 37246911
Alignment:
572 cttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactc 671  Q
    |||||||||| || ||||||||||| || ||||||| || |||||| ||||||||| | |||||| |||||||| |||||  |||| ||||||| || ||    
37246763 cttggttcgttgacataaatggtggatgacccgataacgaaaacctaatagcaggtggtccaatgaatcttgaatagactttgataccatcttaaaaatc 37246862  T
672 gtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggat 720  Q
     | |||| | |||||||||| ||||||| | | |||||||| |||||||    
37246863 attgttgagtctaacacaactccacaaatccgatttgtgaggtgaggat 37246911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #31
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 663 - 739
Target Start/End: Original strand, 50052540 - 50052616
Alignment:
663 ttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||| |||||||||||||||||||||||||||||||| || ||||||  ||||||||| ||| ||||||||||||    
50052540 ttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaagtgaggattgccccccacttataaaca 50052616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #32
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 441 - 516
Target Start/End: Complemental strand, 11589868 - 11589793
Alignment:
441 ttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||| |||| ||||| | |||||||||||||||||||||| ||||||| || ||||||||||||||||||||||    
11589868 ttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaaca 11589793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #33
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 660 - 722
Target Start/End: Complemental strand, 24866283 - 24866221
Alignment:
660 atcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattg 722  Q
    ||||||||| |||||||||||||||||||||||||||||||| || ||||||| |||||||||    
24866283 atcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattg 24866221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #34
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 439 - 516
Target Start/End: Complemental strand, 4155409 - 4155332
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| |||| ||||| | |||||||||||||||||||||| || |||| || ||||||||||||||||||||||    
4155409 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttttgaggtgaggattgcccccacttataaaca 4155332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #35
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 586 - 739
Target Start/End: Original strand, 27670317 - 27670468
Alignment:
586 ataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaa 685  Q
    |||||||  |||||| |||||| ||||||||||||| ||||| | |||| | | |  |||||| ||| |||| ||| |||||| | ||||||||||||||    
27670317 ataaatgacgggtggtccgataacggaaacctgataacaggtggtccaaagaaacgcgaagaggctctgataccatattagaa-tggtggttgggcctaa 27670415  T
686 cacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||||||||||| ||  | |||| ||||||||| ||| ||||||||||||    
27670416 cacaaccccacaaaaccggcctttgaggtgaggattg-cccccacttataaaca 27670468  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #36
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 439 - 516
Target Start/End: Complemental strand, 54567977 - 54567900
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| |||| ||||| | |||||||||||||||||||||| ||||||| || ||||| ||||||||||||||||    
54567977 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggatttcccccacttataaaca 54567900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #37
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 657 - 737
Target Start/End: Original strand, 20303059 - 20303138
Alignment:
657 atcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaa 737  Q
    ||||||||| || ||||||||| ||||||||||| |||||||||| |||||||||| ||||||||| ||| ||||||||||    
20303059 atcatcttaaaaatcgtggttgagcctaacacaatcccacaaaaccggtttgtgaggtgaggattg-cccccacttataaa 20303138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #38
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 657 - 737
Target Start/End: Original strand, 20327609 - 20327688
Alignment:
657 atcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaa 737  Q
    ||||| ||| || |||||||||||||||||||||||||||||||| || ||||||| ||||||||| ||| ||||||||||    
20327609 atcattttaaaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattg-cccccacttataaa 20327688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #39
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 581 - 712
Target Start/End: Complemental strand, 33640211 - 33640079
Alignment:
581 tggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaag-agactcagatatcatcttagaactcgtggttgg 679  Q
    |||| ||||||||||||||| || ||| ||||||  ||||| ||||| | |||| |||| ||| || || ||| ||||||||||||||| | ||| ||||    
33640211 tggacataaatggtgggtggtccaataacggaaatatgataacaggtggtccaacggattttggaggaggctctgatatcatcttagaaattgtgattgg 33640112  T
680 gcctaacacaaccccacaaaactggtttgtgag 712  Q
    ||||||||||| |||||||||| || |||||||    
33640111 gcctaacacaatcccacaaaaccggcttgtgag 33640079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #40
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 463 - 514
Target Start/End: Complemental strand, 1800276 - 1800225
Alignment:
463 acacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaa 514  Q
    |||||||||||||||||||||||||||| || ||||||||||||||||||||    
1800276 acacaaccccacaaaaccggtttgtgaggtgaggattgcccccacttataaa 1800225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #41
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 660 - 739
Target Start/End: Complemental strand, 8019054 - 8018976
Alignment:
660 atcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    ||||||||| | |||||||||||||||||||||||||||||| || ||||||| ||||||||| | | ||||||||||||    
8019054 atcttagaaattgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattg-cacccacttataaaca 8018976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #42
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 453 - 516
Target Start/End: Complemental strand, 9273032 - 9272969
Alignment:
453 gttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    ||||| |||||||||||||||||||||||| ||||||| || || |||||||||||||||||||    
9273032 gttgggcttaacacaaccccacaaaaccggcttgtgaggtgagggttgcccccacttataaaca 9272969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #43
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 664 - 739
Target Start/End: Complemental strand, 33205547 - 33205473
Alignment:
664 tagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    ||||| ||||||||||||||||||||||||| ||||||||| ||||||| ||||||||| |||| || ||||||||    
33205547 tagaaatcgtggttgggcctaacacaaccccgcaaaactggcttgtgaggtgaggattg-cccttacatataaaca 33205473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #44
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 661 - 740
Target Start/End: Complemental strand, 34610646 - 34610567
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaacat 740  Q
    |||||||| | ||||||||| |||||||||||||||||||| |  ||||||| ||||||||| ||| |||||||||||||    
34610646 tcttagaaattgtggttgggtctaacacaaccccacaaaaccgacttgtgaggtgaggattgccccccacttataaacat 34610567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #45
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 461 - 516
Target Start/End: Complemental strand, 49629668 - 49629613
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||||||||||||||||||||||||| || |||||||| |||||||||||||    
49629668 taacacaaccccacaaaaccggtttgtgaggtggggattgccgccacttataaaca 49629613  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #46
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 661 - 739
Target Start/End: Complemental strand, 4155644 - 4155567
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||| |||||||||||||||||||||||| | ||||| || || |||| ||||||||||||| ||||||||||||    
4155644 tcttagaaatcgtggttgggcctaacacaaccctaaaaaaccggcttttgaggtgaggattgtccc-cacttataaaca 4155567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #47
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 638 - 739
Target Start/End: Original strand, 45138946 - 45139047
Alignment:
638 atcttgaag-agactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataa 736  Q
    ||||||||| || ||| |||| |||||||||| ||||||||||| || ||||||||||||||||| || ||||||| ||||||||| ||| ||||||| |    
45138946 atcttgaaggaggctctgataccatcttagaaatcgtggttgggtcttacacaaccccacaaaaccggcttgtgaggtgaggattg-cccccacttatta 45139044  T
737 aca 739  Q
    |||    
45139045 aca 45139047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #48
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 439 - 516
Target Start/End: Complemental strand, 8019053 - 8018976
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| | || ||||| | |||||||||||||||||||||| ||||||| || ||||||| ||||||||||||||    
8019053 tcttagaaattgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcacccacttataaaca 8018976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #49
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 439 - 516
Target Start/End: Complemental strand, 16239676 - 16239599
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| |||| ||||| | |||||||| ||||||||||||| ||||||| || || |||||||||||||||||||    
16239676 tcttagaaatcgtggttgggcctaacacaatcccacaaaaccggcttgtgaggtgaggtttgcccccacttataaaca 16239599  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #50
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 659 - 739
Target Start/End: Complemental strand, 17638321 - 17638243
Alignment:
659 catcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||||| ||||||||||||||||||||||||| ||||||  | ||||||| |||||||||  || ||||||||||||    
17638321 catcttagaaatcgtggttgggcctaacacaacccctcaaaaccagcttgtgaggtgaggattg--ccccacttataaaca 17638243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #51
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 572 - 657
Target Start/End: Complemental strand, 24866216 - 24866132
Alignment:
572 cttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagata 657  Q
    ||||| ||||||| ||||||||| |||||||  ||| ||||||||||||||||||| |||||||| ||||||||||| ||| ||||    
24866216 cttggctcgtggacataaatggtaggtggcca-ataacggaaacctgatagcaggtggcccaatgaatcttgaagaggctctgata 24866132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #52
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 672 - 737
Target Start/End: Original strand, 38791460 - 38791524
Alignment:
672 gtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaa 737  Q
    |||||||||||||||||||||||||||||  | |||||||| |||||||||| |||||||||||||    
38791460 gtggttgggcctaacacaaccccacaaaatcgatttgtgaggtgaggattgt-cctcacttataaa 38791524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #53
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 463 - 516
Target Start/End: Complemental strand, 50930763 - 50930710
Alignment:
463 acacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    ||||||||||||||||||| |||||||| || ||||||||||||||||||||||    
50930763 acacaaccccacaaaaccgttttgtgaggtgaggattgcccccacttataaaca 50930710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #54
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 439 - 516
Target Start/End: Complemental strand, 54368601 - 54368524
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| |||| |||||   ||||||||||||| |||||||| ||||||| || ||||||||||||||||||||||    
54368601 tcttagaaatcgtggttgggtctaacacaaccccataaaaccggcttgtgaggtgaggattgcccccacttataaaca 54368524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #55
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 581 - 645
Target Start/End: Original strand, 21809059 - 21809123
Alignment:
581 tggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaa 645  Q
    |||| ||||||| ||||| | ||||||||||||||||||||||||||  ||||||||||||||||    
21809059 tggacataaatgatgggtagtccgatagcggaaacctgatagcaggtgacccaatggatcttgaa 21809123  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #56
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 566 - 690
Target Start/End: Original strand, 50052677 - 50052800
Alignment:
566 attggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatctta 665  Q
    ||||| |||||| |||||| ||| |||| || || ||||| ||| ||||||||||||||||| |||| |||||||||  |||| ||| ||||  || |||    
50052677 attgggcttggtgcgtggatatagatggcggatgacccgacagcagaaacctgatagcaggtggccc-atggatcttagagaggctctgatacaatatta 50052775  T
666 gaactcgtggttgggcctaacacaa 690  Q
    ||| | |||||||||||||||||||    
50052776 gaaatagtggttgggcctaacacaa 50052800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #57
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 515 - 603
Target Start/End: Complemental strand, 54368718 - 54368630
Alignment:
515 catcttatattcgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggccc 603  Q
    |||||| ||| |||||| |||| ||||||||||| | ||||||||||||  ||||| |||| ||| |||| ||||||||||||||||||    
54368718 catcttctatccgatgttggactcttaatacaccccgtcacaaccagcaaaattgggcttgattcctggacataaatggtgggtggccc 54368630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #58
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 461 - 516
Target Start/End: Original strand, 472081 - 472136
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||||||||||||||||| ||||||| |  ||||||||||||||||||||||    
472081 taacacaaccccacaaaaccggcttgtgaggtaaggattgcccccacttataaaca 472136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #59
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 465 - 516
Target Start/End: Original strand, 45138827 - 45138878
Alignment:
465 acaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||||||||||||| ||||||| || ||||||||||||||||||||||    
45138827 acaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaaca 45138878  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #60
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 663 - 722
Target Start/End: Original strand, 47702410 - 47702469
Alignment:
663 ttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattg 722  Q
    |||||| ||||||||||||||||||||||||||||||||  | |||| ||||||||||||    
47702410 ttagaaatcgtggttgggcctaacacaaccccacaaaaccagcttgtaagatgaggattg 47702469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #61
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 661 - 739
Target Start/End: Original strand, 50083079 - 50083157
Alignment:
661 tcttagaactcgtggttgggcctaacacaa-ccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||| || |||||||||||||||||| ||||||||||| || ||||||| |||||||| |||| ||||||||||||    
50083079 tcttagaaatcatggttgggcctaacacaacccccacaaaaccggcttgtgaggtgaggatt-tcccccacttataaaca 50083157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #62
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 661 - 739
Target Start/End: Original strand, 472059 - 472136
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||| ||| |||||||| ||||||||||||||||||||||| || ||||||| | ||||||| ||| ||||||||||||    
472059 tctttgaaatcgtggtttggcctaacacaaccccacaaaaccggcttgtgaggtaaggattg-cccccacttataaaca 472136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #63
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 601 - 739
Target Start/End: Complemental strand, 9273106 - 9272969
Alignment:
601 cccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaa 700  Q
    ||||||| | ||||||||||| || || || |||   ||| |||||||  || |||| ||| |||||| | |||||||||| ||||||||||||||||||    
9273106 cccgataacagaaacctgataacaagtggctcaaataatcatgaagaggttctgataccatattagaaatggtggttgggcttaacacaaccccacaaaa 9273007  T
701 ctggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    | || ||||||| ||||| ||| ||| ||||||||||||    
9273006 ccggcttgtgaggtgagggttg-cccccacttataaaca 9272969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #64
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 581 - 643
Target Start/End: Original strand, 11659600 - 11659662
Alignment:
581 tggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttg 643  Q
    |||| ||||||||||||||| ||||||||| |||||||||||||||| | |||| ||||||||    
11659600 tggacataaatggtgggtggtccgatagcgaaaacctgatagcaggttgtccaacggatcttg 11659662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #65
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 664 - 738
Target Start/End: Original strand, 13574686 - 13574759
Alignment:
664 tagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaac 738  Q
    ||||| |||||||||||||||||||||||||||||||| || ||||||| ||| ||| | ||| |||||||||||    
13574686 tagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgacgatcg-cccgcacttataaac 13574759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #66
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 459 - 513
Target Start/End: Original strand, 21809166 - 21809220
Alignment:
459 cttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataa 513  Q
    |||||||||| || |||||||||| ||||||| ||||||||||||||||||||||    
21809166 cttaacacaatcctacaaaaccggcttgtgaggtgtggattgcccccacttataa 21809220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #67
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 580 - 626
Target Start/End: Complemental strand, 21888571 - 21888525
Alignment:
580 gtggaaataaatggtgggtggcccgatagcggaaacctgatagcagg 626  Q
    ||||| ||||||||||||||| |||||||||||||||||||||||||    
21888571 gtggatataaatggtgggtggtccgatagcggaaacctgatagcagg 21888525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #68
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 629 - 739
Target Start/End: Complemental strand, 22729217 - 22729108
Alignment:
629 gcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctc 728  Q
    ||||| ||||||||| | ||  || |||| |||||||||| | ||||||||||||||||||||| |||||||| || ||||||  ||||||||| ||| |    
22729217 gcccagtggatcttggataggatctgataccatcttagaaattgtggttgggcctaacacaacctcacaaaaccggcttgtgaagtgaggattg-ccccc 22729119  T
729 acttataaaca 739  Q
    |||| ||||||    
22729118 acttgtaaaca 22729108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #69
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 454 - 516
Target Start/End: Original strand, 23708238 - 23708300
Alignment:
454 ttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||| |||||||| | ||||||||||| ||||||| || ||||||||||||||||||||||    
23708238 ttggacctaacacaatctcacaaaaccggcttgtgaggtgaggattgcccccacttataaaca 23708300  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #70
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 454 - 516
Target Start/End: Original strand, 23726694 - 23726756
Alignment:
454 ttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||| |||||||| | ||||||||||| ||||||| || ||||||||||||||||||||||    
23726694 ttggacctaacacaatctcacaaaaccggcttgtgaggtgaggattgcccccacttataaaca 23726756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #71
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 454 - 516
Target Start/End: Original strand, 23745150 - 23745212
Alignment:
454 ttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||| |||||||| | ||||||||||| ||||||| || ||||||||||||||||||||||    
23745150 ttggacctaacacaatctcacaaaaccggcttgtgaggtgaggattgcccccacttataaaca 23745212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #72
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 454 - 516
Target Start/End: Original strand, 24063675 - 24063737
Alignment:
454 ttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||| |||||||| | ||||||||||| ||||||| || ||||||||||||||||||||||    
24063675 ttggacctaacacaatctcacaaaaccggcttgtgaggtgaggattgcccccacttataaaca 24063737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #73
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 661 - 739
Target Start/End: Complemental strand, 31317551 - 31317474
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||| ||||||||||||||||||||||||| |||||  || ||||||| ||| |||| |||| ||||||||||||    
31317551 tcttagaaatcgtggttgggcctaacacaaccccgcaaaatcggcttgtgaggtgatgattttccc-cacttataaaca 31317474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #74
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 661 - 739
Target Start/End: Complemental strand, 41915255 - 41915179
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||| | ||||||||||||||||||| || | |||||||||||||||| ||||||||| ||| ||||||||||||    
41915255 tcttagaatttgtggttgggcctaacacaaacc-ataaaactggtttgtgaggtgaggattg-cccccacttataaaca 41915179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #75
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 672 - 737
Target Start/End: Complemental strand, 1800289 - 1800225
Alignment:
672 gtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaa 737  Q
    ||||||||| || ||||||||||||||||| |||||||||| ||||||||| ||| ||||||||||    
1800289 gtggttgggtcttacacaaccccacaaaaccggtttgtgaggtgaggattg-cccccacttataaa 1800225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #76
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 526 - 619
Target Start/End: Complemental strand, 22729713 - 22729620
Alignment:
526 cgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctga 619  Q
    ||||||||| | ||||| |||||   |||| || |||| |||||| ||||||||||||| |||||| |||||||  ||||||||||||||||||    
22729713 cgatgtgggcctcttaacacacccgttcacgactagcattattgggcttggttcgtggacataaattgtgggtgatccgatagcggaaacctga 22729620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #77
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 605 - 686
Target Start/End: Complemental strand, 35018616 - 35018535
Alignment:
605 atagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaac 686  Q
    ||||||||||||| |||||| ||  ||||| |||||||| | || ||| ||||||||||||||| | |||||||||||||||    
35018616 atagcggaaaccttatagcaagtgacccaacggatcttggataggctctgatatcatcttagaatttgtggttgggcctaac 35018535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #78
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 439 - 516
Target Start/End: Complemental strand, 39269416 - 39269339
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    ||||| || |||||||| | | |||||||| ||| ||||||||| ||||||| || ||||||||||||||||||||||    
39269416 tcttaaaaatcgtagttaggcctaacacaatccctcaaaaccggcttgtgaggtgaggattgcccccacttataaaca 39269339  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #79
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 439 - 516
Target Start/End: Complemental strand, 39620411 - 39620334
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| |||| ||||| ||||||||||||||||||||| || || |||| || || || ||||||||||||||||    
39620411 tcttagaaatcgtggttgggcttaacacaaccccacaaaactggcttatgaggtgcgggttacccccacttataaaca 39620334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #80
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 463 - 516
Target Start/End: Original strand, 45138994 - 45139047
Alignment:
463 acacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||||||||||||||| ||||||| || ||||||||||||||||| ||||    
45138994 acacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttattaaca 45139047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #81
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 464 - 516
Target Start/End: Original strand, 23691216 - 23691268
Alignment:
464 cacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    ||||||| ||||||||||| ||||||| || ||||||||||||||||||||||    
23691216 cacaacctcacaaaaccggcttgtgaggtgaggattgcccccacttataaaca 23691268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #82
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 464 - 516
Target Start/End: Original strand, 23708016 - 23708068
Alignment:
464 cacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    ||||||| ||||||||||| ||||||| || ||||||||||||||||||||||    
23708016 cacaacctcacaaaaccggcttgtgaggtgaggattgcccccacttataaaca 23708068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #83
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 464 - 516
Target Start/End: Original strand, 23726472 - 23726524
Alignment:
464 cacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    ||||||| ||||||||||| ||||||| || ||||||||||||||||||||||    
23726472 cacaacctcacaaaaccggcttgtgaggtgaggattgcccccacttataaaca 23726524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #84
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 464 - 516
Target Start/End: Original strand, 23744928 - 23744980
Alignment:
464 cacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    ||||||| ||||||||||| ||||||| || ||||||||||||||||||||||    
23744928 cacaacctcacaaaaccggcttgtgaggtgaggattgcccccacttataaaca 23744980  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #85
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 464 - 516
Target Start/End: Original strand, 24063453 - 24063505
Alignment:
464 cacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    ||||||| ||||||||||| ||||||| || ||||||||||||||||||||||    
24063453 cacaacctcacaaaaccggcttgtgaggtgaggattgcccccacttataaaca 24063505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #86
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 647 - 739
Target Start/End: Complemental strand, 39269430 - 39269339
Alignment:
647 agactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||| |||| ||||||| || |||| ||| |||||||||||| ||| |||||| || ||||||| ||||||||| ||| ||||||||||||    
39269430 agactctgataccatcttaaaaatcgtagttaggcctaacacaatccctcaaaaccggcttgtgaggtgaggattg-cccccacttataaaca 39269339  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #87
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 660 - 704
Target Start/End: Complemental strand, 39620412 - 39620368
Alignment:
660 atcttagaactcgtggttgggcctaacacaaccccacaaaactgg 704  Q
    ||||||||| |||||||||||| ||||||||||||||||||||||    
39620412 atcttagaaatcgtggttgggcttaacacaaccccacaaaactgg 39620368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #88
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 461 - 517
Target Start/End: Complemental strand, 45828082 - 45828026
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaacat 517  Q
    |||||||||| ||||||||||| ||||||| || |||||||||| ||||||||||||    
45828082 taacacaacctcacaaaaccggcttgtgaggtgaggattgccccaacttataaacat 45828026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #89
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 440 - 516
Target Start/End: Complemental strand, 45828330 - 45828254
Alignment:
440 cttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    ||||||| || | ||||| | |||||||||||||||||||| | ||||||| ||  |||||||||||||||||||||    
45828330 cttagaaatcatggttgggcctaacacaaccccacaaaacctgcttgtgaggtggagattgcccccacttataaaca 45828254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #90
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 441 - 516
Target Start/End: Original strand, 50052540 - 50052616
Alignment:
441 ttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattg-cccccacttataaaca 516  Q
    |||||| |||| ||||| | |||||||||||||||||||||| ||||||  || |||||| ||||||||||||||||    
50052540 ttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaagtgaggattgccccccacttataaaca 50052616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #91
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 437 - 516
Target Start/End: Original strand, 50083077 - 50083157
Alignment:
437 agtcttagaactcgtagttggacttaacacaacccc-acaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||||| || | ||||| | |||||||||||| |||||||||| ||||||| || ||||| ||||||||||||||||    
50083077 agtcttagaaatcatggttgggcctaacacaacccccacaaaaccggcttgtgaggtgaggatttcccccacttataaaca 50083157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #92
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 670 - 709
Target Start/End: Complemental strand, 1353524 - 1353485
Alignment:
670 tcgtggttgggcctaacacaaccccacaaaactggtttgt 709  Q
    |||||||||||||||||||||||||||||||| |||||||    
1353524 tcgtggttgggcctaacacaaccccacaaaaccggtttgt 1353485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #93
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 461 - 516
Target Start/End: Complemental strand, 9273258 - 9273203
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||||||||||||||| | ||||||  || ||||||||||||||||||||||    
9273258 taacacaaccccacaaaaccagcttgtgaagtgaggattgcccccacttataaaca 9273203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #94
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 461 - 516
Target Start/End: Original strand, 13574942 - 13574997
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    ||||||||||||||||||| || ||||||| || ||||| ||||||||||||||||    
13574942 taacacaaccccacaaaactggcttgtgaggtgaggatttcccccacttataaaca 13574997  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #95
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 454 - 517
Target Start/End: Complemental strand, 16239897 - 16239834
Alignment:
454 ttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaacat 517  Q
    |||||| |||||||||||||||||||||  ||||||| || |  ||||||||||||||||||||    
16239897 ttggacctaacacaaccccacaaaaccgacttgtgaggtgagatttgcccccacttataaacat 16239834  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #96
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 461 - 516
Target Start/End: Original strand, 23610392 - 23610447
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    ||||||||||||||||||||||  |||||| || ||||| ||||||||||||||||    
23610392 taacacaaccccacaaaaccggcctgtgagttgaggattacccccacttataaaca 23610447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #97
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 439 - 502
Target Start/End: Complemental strand, 24866282 - 24866219
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcc 502  Q
    |||||||| |||| ||||| | |||||||||||||||||||||| ||||||| || ||||||||    
24866282 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcc 24866219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #98
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 461 - 516
Target Start/End: Original strand, 27670413 - 27670468
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    ||||||||||||||||||||||  | |||| || ||||||||||||||||||||||    
27670413 taacacaaccccacaaaaccggcctttgaggtgaggattgcccccacttataaaca 27670468  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #99
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 661 - 739
Target Start/End: Complemental strand, 18757927 - 18757850
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||| ||| |||||||||||||||||||||||||||||||| |  ||||||  ||||||| | ||| ||||||||||||    
18757927 tcttggaaatcgtggttgggcctaacacaaccccacaaaaccgccttgtgatgtgaggatcg-cccccacttataaaca 18757850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #100
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 454 - 516
Target Start/End: Original strand, 23691438 - 23691500
Alignment:
454 ttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||| |||||||| | |||||| |||| ||||||| || ||||||||||||||||||||||    
23691438 ttggacctaacacaatctcacaaatccggcttgtgaggtgaggattgcccccacttataaaca 23691500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #101
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 581 - 687
Target Start/End: Original strand, 34659156 - 34659261
Alignment:
581 tggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttggg 680  Q
    |||| ||||||| ||||||| ||||||| |||||| | |||||| || | |||| ||||||||||||| ||| |||| ||||||| || |||| |||| |    
34659156 tggatataaatgatgggtggtccgatagtggaaacttaatagcatgtggtccaacggatcttgaagaggctctgataccatctta-aaatcgtagttgag 34659254  T
681 cctaaca 687  Q
    |||||||    
34659255 cctaaca 34659261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #102
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 665 - 739
Target Start/End: Original strand, 45138805 - 45138878
Alignment:
665 agaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||| ||||||||||| || | ||||||||||||||| || ||||||| ||||||||| ||| ||||||||||||    
45138805 agaaatcgtggttgggtctcatacaaccccacaaaaccggcttgtgaggtgaggattg-cccccacttataaaca 45138878  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #103
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 633 - 701
Target Start/End: Complemental strand, 1800139 - 1800070
Alignment:
633 aatggatcttgaag-agactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaac 701  Q
    |||||||||||||| || ||| |||| |||||||||| | |||||||||||||| |||||| ||||||||    
1800139 aatggatcttgaaggaggctctgataccatcttagaaattgtggttgggcctaatacaaccgcacaaaac 1800070  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #104
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 439 - 516
Target Start/End: Complemental strand, 4155644 - 4155567
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| |||| ||||| | ||||||||||| | |||||||| || |||| || |||||| |||||||||||||||    
4155644 tcttagaaatcgtggttgggcctaacacaaccctaaaaaaccggcttttgaggtgaggattgtccccacttataaaca 4155567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #105
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 442 - 515
Target Start/End: Original strand, 13574686 - 13574759
Alignment:
442 tagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaac 515  Q
    ||||| |||| ||||| | |||||||||||||||||||||| ||||||| ||  ||| |||| |||||||||||    
13574686 tagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgacgatcgcccgcacttataaac 13574759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #106
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 562 - 718
Target Start/End: Original strand, 15019415 - 15019572
Alignment:
562 cactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatct-tgaagagactcagatatca 660  Q
    ||||||||  |||||||||||||  ||||||||||||   ||||||||| ||| ||||||| |||| |||||||| ||||  || ||  |||  ||| ||    
15019415 cactattgagcttggttcgtggatttaaatggtgggttatccgatagcgaaaatctgatagtaggtggcccaatgaatctcggaggatgctctaatacca 15019514  T
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgagg 718  Q
    |||||||| |||||||||  | |||||||||| || ||||  | |||||||| |||||    
15019515 tcttagaaatcgtggttgaacataacacaacctcataaaatcgatttgtgaggtgagg 15019572  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #107
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 439 - 516
Target Start/End: Complemental strand, 17638319 - 17638243
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| |||| ||||| | |||||||||||| ||||||| | ||||||| || |||||| |||||||||||||||    
17638319 tcttagaaatcgtggttgggcctaacacaacccctcaaaaccagcttgtgaggtgaggattg-ccccacttataaaca 17638243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #108
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 439 - 516
Target Start/End: Complemental strand, 18757927 - 18757850
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||| ||| |||| ||||| | |||||||||||||||||||||  ||||||  || |||| |||||||||||||||||    
18757927 tcttggaaatcgtggttgggcctaacacaaccccacaaaaccgccttgtgatgtgaggatcgcccccacttataaaca 18757850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #109
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 439 - 516
Target Start/End: Complemental strand, 22729185 - 22729108
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| | || ||||| | |||||||||| ||||||||||| ||||||  || ||||||||||||||| ||||||    
22729185 tcttagaaattgtggttgggcctaacacaacctcacaaaaccggcttgtgaagtgaggattgcccccacttgtaaaca 22729108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #110
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 659 - 736
Target Start/End: Complemental strand, 27086677 - 27086601
Alignment:
659 catcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataa 736  Q
    |||||||||| || ||||||||||||||||||| |||||||||    |||| |||||||||||||  |||||||||||    
27086677 catcttagaaatcatggttgggcctaacacaactccacaaaaccaacttgtaagatgaggattgt-actcacttataa 27086601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #111
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 439 - 516
Target Start/End: Complemental strand, 31317313 - 31317237
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| |||| ||||  | |||||||| ||||||||||||| ||||||| || |||||| |||||||||||||||    
31317313 tcttagaaatcgtggttgagcctaacacaatcccacaaaaccggcttgtgaggtgaggattg-ccccacttataaaca 31317237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #112
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 461 - 517
Target Start/End: Complemental strand, 34610624 - 34610567
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgc-ccccacttataaacat 517  Q
    |||||||||||||||||||||  ||||||| || ||||||| ||||||||||||||||    
34610624 taacacaaccccacaaaaccgacttgtgaggtgaggattgccccccacttataaacat 34610567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #113
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 662 - 739
Target Start/End: Complemental strand, 45828330 - 45828254
Alignment:
662 cttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    ||||||| || |||||||||||||||||||||||||||||  | ||||||| ||  ||||| ||| ||||||||||||    
45828330 cttagaaatcatggttgggcctaacacaaccccacaaaacctgcttgtgaggtggagattg-cccccacttataaaca 45828254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #114
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 661 - 721
Target Start/End: Original strand, 2806285 - 2806345
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggatt 721  Q
    |||||||| | ||| | |||||||||| |||||||||||||||| ||||||| ||||||||    
2806285 tcttagaaattgtgttggggcctaacaaaaccccacaaaactggcttgtgaggtgaggatt 2806345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #115
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 461 - 513
Target Start/End: Original strand, 7697419 - 7697471
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataa 513  Q
    |||||||||||||||||||| | ||||||| ||  ||||||||||||||||||    
7697419 taacacaaccccacaaaaccagcttgtgaggtgatgattgcccccacttataa 7697471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #116
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 672 - 739
Target Start/End: Original strand, 13741111 - 13741178
Alignment:
672 gtggttgggcctaacacaaccccacaaaactggtttgtgagatgagga-ttgtccctcacttataaaca 739  Q
    ||||||||| |||||||||||||| ||||| || ||||||| |||||| ||||||| ||||||||||||    
13741111 gtggttgggtctaacacaaccccaaaaaaccggcttgtgaggtgaggatttgtccc-cacttataaaca 13741178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #117
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 670 - 721
Target Start/End: Original strand, 6487341 - 6487392
Alignment:
670 tcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggatt 721  Q
    |||||||||||||||| ||||||||| ||||| || ||||||| ||||||||    
6487341 tcgtggttgggcctaaaacaaccccataaaaccggcttgtgaggtgaggatt 6487392  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #118
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 661 - 736
Target Start/End: Original strand, 7697397 - 7697471
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataa 736  Q
    |||||||| | |||||| |||||||||||||||||||||||  | ||||||| ||| ||||| ||| |||||||||    
7697397 tcttagaaattgtggttaggcctaacacaaccccacaaaaccagcttgtgaggtgatgattg-cccccacttataa 7697471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #119
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 672 - 739
Target Start/End: Complemental strand, 9273269 - 9273203
Alignment:
672 gtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    ||||||| ||||||||||||||||||||||  | ||||||  ||||||||| ||| ||||||||||||    
9273269 gtggttgagcctaacacaaccccacaaaaccagcttgtgaagtgaggattg-cccccacttataaaca 9273203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #120
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 437 - 516
Target Start/End: Complemental strand, 41915257 - 41915179
Alignment:
437 agtcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||||| | || ||||| | |||||||| || | ||||| |||||||||| || ||||||||||||||||||||||    
41915257 agtcttagaatttgtggttgggcctaacacaaacc-ataaaactggtttgtgaggtgaggattgcccccacttataaaca 41915179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #121
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 661 - 740
Target Start/End: Original strand, 44576254 - 44576332
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaacat 740  Q
    |||||||| |||||||||||  |||||||| |||||||||| |||||||| |  | ||||| |||| |||||||||||||    
44576254 tcttagaaatcgtggttgggtgtaacacaaacccacaaaaccggtttgtgcggcgcggatt-tcccacacttataaacat 44576332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #122
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 453 - 491
Target Start/End: Original strand, 20303398 - 20303436
Alignment:
453 gttggacttaacacaaccccacaaaaccggtttgtgaga 491  Q
    ||||||| |||||||||||||||||||||| ||||||||    
20303398 gttggacctaacacaaccccacaaaaccggcttgtgaga 20303436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #123
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 688 - 730
Target Start/End: Original strand, 21808798 - 21808840
Alignment:
688 caaccccacaaaactggtttgtgagatgaggattgtccctcac 730  Q
    ||||||||||||||||||||||||| |||  ||||||||||||    
21808798 caaccccacaaaactggtttgtgaggtgaatattgtccctcac 21808840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #124
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 605 - 739
Target Start/End: Original strand, 29215758 - 29215890
Alignment:
605 atagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactgg 704  Q
    ||||| |||| ||||||  |||| ||| |||| || |||||||  |||  |||||||||||||| || ||||| | ||||||||  ||||||||||||||    
29215758 atagcagaaatctgataagaggtggcctaatgaattttgaagaagctctaatatcatcttagaaatcatggttagacctaacac-gccccacaaaactgg 29215856  T
705 tttgtgagatgaggattgtccctcacttataaaca 739  Q
      |||||| |||||||| || | ||||||||||||    
29215857 catgtgaggtgaggattatcac-cacttataaaca 29215890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #125
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 670 - 720
Target Start/End: Original strand, 32215523 - 32215573
Alignment:
670 tcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggat 720  Q
    |||||||||||||||||||||| ||||||||| || |||| || |||||||    
32215523 tcgtggttgggcctaacacaactccacaaaaccggcttgtaaggtgaggat 32215573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #126
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 661 - 739
Target Start/End: Complemental strand, 42420909 - 42420832
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||| |||||| | ||||| ||||||||| ||||||||||||||| || ||| ||||| | | ||||||||||||    
42420909 tcttagaaatcgtggataggcctgacacaaccctacaaaactggtttgtaaggtgaagattg-ctcccacttataaaca 42420832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #127
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 439 - 517
Target Start/End: Original strand, 44576254 - 44576332
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaacat 517  Q
    |||||||| |||| |||||   |||||||| ||||||||||||||||||| |  | ||||| ||| |||||||||||||    
44576254 tcttagaaatcgtggttgggtgtaacacaaacccacaaaaccggtttgtgcggcgcggatttcccacacttataaacat 44576332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #128
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 685 - 739
Target Start/End: Complemental strand, 50930763 - 50930710
Alignment:
685 acacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    ||||||||||||||||| | |||||||| ||||||||| ||| ||||||||||||    
50930763 acacaaccccacaaaaccgttttgtgaggtgaggattg-cccccacttataaaca 50930710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #129
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 663 - 724
Target Start/End: Complemental strand, 11590088 - 11590027
Alignment:
663 ttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtc 724  Q
    |||||| | |||||||||||||| |||| |||| ||||| || ||||||| |||||||||||    
11590088 ttagaagttgtggttgggcctaatacaatcccataaaaccggcttgtgaggtgaggattgtc 11590027  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #130
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 654 - 695
Target Start/End: Complemental strand, 21833440 - 21833399
Alignment:
654 gatatcatcttagaactcgtggttgggcctaacacaacccca 695  Q
    |||| ||| |||||| ||||||||||||||||||||||||||    
21833440 gataccatgttagaaatcgtggttgggcctaacacaacccca 21833399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #131
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 678 - 739
Target Start/End: Original strand, 23610387 - 23610447
Alignment:
678 gggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||||||||||||||||||| ||  |||||| ||||||||  ||| ||||||||||||    
23610387 gggcctaacacaaccccacaaaaccggcctgtgagttgaggatt-acccccacttataaaca 23610447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #132
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 661 - 694
Target Start/End: Complemental strand, 27086726 - 27086693
Alignment:
661 tcttagaactcgtggttgggcctaacacaacccc 694  Q
    |||||||| |||||||||||||||||||||||||    
27086726 tcttagaaatcgtggttgggcctaacacaacccc 27086693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #133
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 654 - 739
Target Start/End: Original strand, 30179700 - 30179784
Alignment:
654 gatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||| ||||||| || |||||||||||| ||||| || || |||||||||  ||||||| ||||||||  ||| ||||||||||||    
30179700 gataccatcttataaatcgtggttgggcataacataatcctacaaaactgacttgtgaggtgaggatt-acccccacttataaaca 30179784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #134
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 439 - 516
Target Start/End: Complemental strand, 31317551 - 31317474
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| |||| ||||| | |||||||||||| ||||| ||| ||||||| ||  ||||  |||||||||||||||    
31317551 tcttagaaatcgtggttgggcctaacacaaccccgcaaaatcggcttgtgaggtgatgattttccccacttataaaca 31317474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #135
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 461 - 514
Target Start/End: Original strand, 38791471 - 38791524
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaa 514  Q
    |||||||||||||||||| || |||||||| || |||||| || ||||||||||    
38791471 taacacaaccccacaaaatcgatttgtgaggtgaggattgtcctcacttataaa 38791524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #136
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 587 - 691
Target Start/End: Complemental strand, 39620252 - 39620147
Alignment:
587 taaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatctt-gaagagactcagatatcatcttagaactcgtggttgggcctaa 685  Q
    ||||||||||||| | ||||| || ||| | |||||||||| ||||||  |||||| || ||| ||| |||| |||||||||| |||||||||  | |||    
39620252 taaatggtgggtgactcgataacgtaaatcggatagcaggtggcccaacagatcttggaggaggctctgataccatcttagaaatcgtggttgaacttaa 39620153  T
686 cacaac 691  Q
    ||||||    
39620152 cacaac 39620147  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #137
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 441 - 502
Target Start/End: Original strand, 47702410 - 47702471
Alignment:
441 ttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcc 502  Q
    |||||| |||| ||||| | |||||||||||||||||||| | |||| ||||| ||||||||    
47702410 ttagaaatcgtggttgggcctaacacaaccccacaaaaccagcttgtaagatgaggattgcc 47702471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0692 (Bit Score: 124; Significance: 2e-63; HSPs: 4)
Name: scaffold0692
Description:

Target: scaffold0692; HSP #1
Raw Score: 124; E-Value: 2e-63
Query Start/End: Original strand, 544 - 739
Target Start/End: Original strand, 5636 - 5830
Alignment:
544 acaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttg 643  Q
    ||||| |||||| |||||||||||||| ||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| || ||||||||||||    
5636 acaccccctcacgaccagcactattgggcttggttcgtggacataaatggtgggtggtccgatagcggaaacctgatagcaggtggctcaatggatcttg 5735  T
644 aagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
     |||| ||| |||| |||||||||| ||||||||||||||||||||||||| |||||| || ||||||||||||||||| ||| ||||||||||||    
5736 gagaggctctgataccatcttagaaatcgtggttgggcctaacacaaccccgcaaaaccggcttgtgagatgaggattg-cccccacttataaaca 5830  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0692; HSP #2
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 439 - 516
Target Start/End: Original strand, 5753 - 5830
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| |||| ||||| | |||||||||||| ||||||||| |||||||||| ||||||||||||||||||||||    
5753 tcttagaaatcgtggttgggcctaacacaaccccgcaaaaccggcttgtgagatgaggattgcccccacttataaaca 5830  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0692; HSP #3
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 461 - 516
Target Start/End: Original strand, 5565 - 5620
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||||||| ||||||||| ||||||  || ||||||||||||||||||||||    
5565 taacacaaccccgcaaaaccggcttgtgaagtgaggattgcccccacttataaaca 5620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0692; HSP #4
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 673 - 739
Target Start/End: Original strand, 5555 - 5620
Alignment:
673 tggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||||||||||||||||| |||||| || ||||||  ||||||||| ||| ||||||||||||    
5555 tggttgggcctaacacaaccccgcaaaaccggcttgtgaagtgaggattg-cccccacttataaaca 5620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0519 (Bit Score: 122; Significance: 4e-62; HSPs: 1)
Name: scaffold0519
Description:

Target: scaffold0519; HSP #1
Raw Score: 122; E-Value: 4e-62
Query Start/End: Original strand, 439 - 739
Target Start/End: Complemental strand, 2236 - 1924
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaa-------------catcttatatt 525  Q
    |||||||| | || ||||| | |||||||||||||||||||||| |||| || || ||||||||||||||||||||             ||| |  | |     
2236 tcttagaaatggtggttgggcctaacacaaccccacaaaaccggcttgtaaggtgaggattgcccccacttataaacacattgtcaggccatgtcctgtc 2137  T
526 cgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcag 625  Q
    ||||||||||| ||||| ||||| |||||| |||||||||||||| ||||||||||||| |||||||||||||| | ||||||||||||||||||| |||    
2136 cgatgtgggactcttaacacaccccctcacgaccagcactattgggcttggttcgtggacataaatggtgggtgactcgatagcggaaacctgataacag 2037  T
626 gtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtcc 725  Q
    || ||||||||||||||| |||| ||| |||| |||||||||| | |||||||||||||||||||||||||||||| || |||| || ||||||||| ||    
2036 gtggcccaatggatcttggagaggctctgataccatcttagaaatggtggttgggcctaacacaaccccacaaaaccggcttgtaaggtgaggattg-cc 1938  T
726 ctcacttataaaca 739  Q
    | ||||||||||||    
1937 cccacttataaaca 1924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 122; Significance: 4e-62; HSPs: 155)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 122; E-Value: 4e-62
Query Start/End: Original strand, 526 - 739
Target Start/End: Complemental strand, 21861514 - 21861302
Alignment:
526 cgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcag 625  Q
    |||||||| || ||||| ||||| |||||| |||||||||||| | ||||||||||||| |||||||||||||||||||||||||||||||||||| |||    
21861514 cgatgtggaactcttaacacaccccctcacgaccagcactattaggcttggttcgtggacataaatggtgggtggcccgatagcggaaacctgataacag 21861415  T
626 gtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtcc 725  Q
    || ||||||||||||||| |||| ||| |||| |||||||||| | ||||||||||||||||||| |||||||||| || |||| || ||||||||| ||    
21861414 gtggcccaatggatcttggagaggctctgataccatcttagaaatggtggttgggcctaacacaatcccacaaaaccggcttgtaaggtgaggattg-cc 21861316  T
726 ctcacttataaaca 739  Q
    ||||||||||||||    
21861315 ctcacttataaaca 21861302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 122; E-Value: 4e-62
Query Start/End: Original strand, 526 - 739
Target Start/End: Complemental strand, 29469825 - 29469613
Alignment:
526 cgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcag 625  Q
    ||||||||||| ||||| ||||| |||||| |||||||||||||| |||| |||||||| |||||||||||||||||||||||||||| ||||||| |||    
29469825 cgatgtgggactcttaacacaccccctcacgaccagcactattgggcttgattcgtggacataaatggtgggtggcccgatagcggaagcctgataacag 29469726  T
626 gtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtcc 725  Q
    || ||||||||||||||| |||| ||| |||| ||| |||||| |||||||||||||||||||||||||||||||| || |||| || ||||||||| ||    
29469725 gtggcccaatggatcttggagaggctctgataccatattagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtaaggtgaggattg-cc 29469627  T
726 ctcacttataaaca 739  Q
    | ||||||||||||    
29469626 cccacttataaaca 29469613  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 121; E-Value: 1e-61
Query Start/End: Original strand, 527 - 739
Target Start/End: Complemental strand, 25620355 - 25620144
Alignment:
527 gatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcagg 626  Q
    ||||| |||| ||||| ||||  | |||| |||| ||||||||| ||||||||||||| |||||||||||||||||| ||||||||||||||||||||||    
25620355 gatgtaggactcttaacacacaccttcacgaccaacactattgggcttggttcgtggacataaatggtgggtggcccaatagcggaaacctgatagcagg 25620256  T
627 tagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccc 726  Q
    | ||||||||||||||| |||| ||| |||| |||||||||| |||||||||||||||||||||||||||||||| || ||||||| ||||||||| |||    
25620255 tggcccaatggatcttggagaggctctgataccatcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattg-ccc 25620157  T
727 tcacttataaaca 739  Q
     ||||||||||||    
25620156 ccacttataaaca 25620144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 117; E-Value: 4e-59
Query Start/End: Original strand, 527 - 739
Target Start/End: Original strand, 36277091 - 36277302
Alignment:
527 gatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcagg 626  Q
    |||||| ||| ||||| ||||| |||||| |||||||||||||| ||||||||||||| ||||||||||||||| ||||||||||||||||||||| |||    
36277091 gatgtgagactcttaacacaccccctcacgaccagcactattgggcttggttcgtggacataaatggtgggtggtccgatagcggaaacctgatagtagg 36277190  T
627 tagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccc 726  Q
    | ||||||||||||||| |||| ||| |||| |||||||||| ||||||||||| |||||||||||||||||||  |  ||||||| ||||||||| |||    
36277191 tggcccaatggatcttggagaggctctgataacatcttagaaatcgtggttgggactaacacaaccccacaaaatcgacttgtgaggtgaggattg-ccc 36277289  T
727 tcacttataaaca 739  Q
     ||||||||||||    
36277290 ccacttataaaca 36277302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 103; E-Value: 8e-51
Query Start/End: Original strand, 526 - 700
Target Start/End: Complemental strand, 33834411 - 33834237
Alignment:
526 cgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcag 625  Q
    ||||||||||| |||||  |||| | |||| |||| ||||||||| ||||||||||||| ||||||||||||||||||||||| | ||||||||||||||    
33834411 cgatgtgggactcttaacccaccccttcacgaccaacactattgggcttggttcgtggacataaatggtgggtggcccgatagggaaaacctgatagcag 33834312  T
626 gtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaa 700  Q
    || ||||||||||||||| |||| ||| |||| |||||||||| | |||||||||||||||||||||||||||||    
33834311 gtggcccaatggatcttggagaggctctgataccatcttagaaatggtggttgggcctaacacaaccccacaaaa 33834237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 102; E-Value: 3e-50
Query Start/End: Original strand, 526 - 699
Target Start/End: Complemental strand, 1596813 - 1596640
Alignment:
526 cgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcag 625  Q
    ||||||||||| ||||| ||||   ||||| |||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||| ||     
1596813 cgatgtgggactcttaacacacactctcacgaccagcactattgggcttggttcgtggacataaatggtgggtggcccgatagcggaaacctgataacat 1596714  T
626 gtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaa 699  Q
    || ||||||||||||||| |||| ||| |||| |||||||||| | |||||| |||||||||||||||||||||    
1596713 gtggcccaatggatcttggagaggctctgataccatcttagaaattgtggttaggcctaacacaaccccacaaa 1596640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 99; E-Value: 2e-48
Query Start/End: Original strand, 537 - 722
Target Start/End: Original strand, 48661429 - 48661615
Alignment:
537 gcttaatacaccacctcac-aaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaat 635  Q
    |||||| ||||| |||||| ||||| ||||||||| ||||||||||||| |||||||||||||||||||| ||||||||||||||||||||| || ||||    
48661429 gcttaacacaccccctcacgaaccaacactattgggcttggttcgtggacataaatggtgggtggcccgaaagcggaaacctgatagcaggtggctcaat 48661528  T
636 ggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattg 722  Q
    || |||| ||||| ||| |||||||| |||||| ||||||||||| ||||||||| | |||||||| || ||||||| |||||||||    
48661529 ggttcttaaagaggctctgatatcatattagaaatcgtggttgggtctaacacaatctcacaaaaccggcttgtgaggtgaggattg 48661615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 94; E-Value: 2e-45
Query Start/End: Original strand, 526 - 737
Target Start/End: Original strand, 33996178 - 33996385
Alignment:
526 cgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcag 625  Q
    ||||||||||| |||||  |||  |||||| | || ||||||||| ||||||||||||| ||||||||||||||||||||| ||||||||||||||||||    
33996178 cgatgtgggactcttaactcacaccctcacgatcaacactattgggcttggttcgtggacataaatggtgggtggcccgattgcggaaacctgatagcag 33996277  T
626 gtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtcc 725  Q
    || ||||||||||   || |||| ||| |||| |||||||||| |||||||||||||||||||||| ||||||||| |  ||||||| ||| ||||| ||    
33996278 gtggcccaatgga---tggagaggctctgataccatcttagaaatcgtggttgggcctaacacaactccacaaaaccgacttgtgaggtgaagattg-cc 33996373  T
726 ctcacttataaa 737  Q
    | ||||||||||    
33996374 cccacttataaa 33996385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 93; E-Value: 7e-45
Query Start/End: Original strand, 550 - 722
Target Start/End: Complemental strand, 4886525 - 4886353
Alignment:
550 cctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagaga 649  Q
    |||||| ||||| |||||||| ||||||||||||| |||||||||||||||| ||||||  ||||| ||||||||||| ||||||||||||||| |||||    
4886525 cctcacgaccagtactattgggcttggttcgtggacataaatggtgggtggctcgatagtagaaacttgatagcaggtggcccaatggatcttggagaga 4886426  T
650 ctcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattg 722  Q
    | | |||| |||||||||| ||||||||||||||||||||||| | | |||| || ||||||| |||||||||    
4886425 ccctgataccatcttagaaatcgtggttgggcctaacacaacctcgccaaaccggcttgtgaggtgaggattg 4886353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 90; E-Value: 5e-43
Query Start/End: Original strand, 521 - 739
Target Start/End: Complemental strand, 22574826 - 22574613
Alignment:
521 atattcgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgat 620  Q
    |||| ||||||| ||| ||||| |||||||||||| |||| ||||||||| |||||||||| || ||||||||||||||| |||||||| ||||||||||    
22574826 atatccgatgtgagactcttaacacaccacctcacgaccaacactattgggcttggttcgtagacataaatggtgggtggtccgatagctgaaacctgat 22574727  T
621 agcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggat 720  Q
    ||||||| ||||||||||||||| ||||||||  ||| |||| ||||| | ||||||| |||||||     |||||||||| || ||||||| |||| ||    
22574726 agcaggtggcccaatggatcttggagagactcttataccatcatagaaattgtggttgagcctaac----gcccacaaaaccggcttgtgaggtgagaat 22574631  T
721 tgtccctcacttataaaca 739  Q
    || | ||||||||||||||    
22574630 tg-ctctcacttataaaca 22574613  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 89; E-Value: 2e-42
Query Start/End: Original strand, 439 - 737
Target Start/End: Complemental strand, 31892472 - 31892161
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaa-------------catcttatatt 525  Q
    |||||||| |||| ||||| | ||||||| |||||||||||||| ||||||| ||  ||||| |||||||||||||             ||| ||  ||     
31892472 tcttagaaatcgtggttgggcctaacacatccccacaaaaccggcttgtgaggtgaagattgtccccacttataaatacattgtcatgtcatgttccatc 31892373  T
526 cgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcag 625  Q
    ||||||| ||| ||||| ||||| |||||| |||| || |||||| ||||||||||||| ||||||||||||||||| |||| |||||||||||||||||    
31892372 cgatgtgagactcttaacacaccccctcacgaccatcattattgggcttggttcgtggacataaatggtgggtggcctgataacggaaacctgatagcag 31892273  T
626 gtagcccaatggatcttgaagagactcagatatcatcttagaactcgtgg-ttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtc 724  Q
    || ||||||| | ||||| |||| ||| |||  |||||||||  ||| || |||||||||||| ||| ||||||||| || ||||||| |||||||||||    
31892272 gtggcccaataggtcttggagaggctctgattccatcttagagatcggggtttgggcctaacataactccacaaaaccggcttgtgaggtgaggattgtc 31892173  T
725 cctcacttataaa 737  Q
    || ||||||||||    
31892172 cc-cacttataaa 31892161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 82; E-Value: 3e-38
Query Start/End: Original strand, 528 - 737
Target Start/End: Original strand, 31485525 - 31485733
Alignment:
528 atgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggt 627  Q
    ||||||||| ||||| ||||| |||||| | || |||||||||  ||| |||||||| ||||||||||||||||||||||| | ||||||||||| ||||    
31485525 atgtgggactcttaacacaccccctcacgaacaacactattgggtttgattcgtggatataaatggtgggtggcccgatagtgaaaacctgatagtaggt 31485624  T
628 agcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccct 727  Q
     ||||||||||||||| || | |||  ||| |||||||||| | |||||| |||||||||||||  |||||||| || |||| || ||||||||| |||     
31485625 ggcccaatggatcttgtagcggctcttataccatcttagaaattgtggttaggcctaacacaacttcacaaaaccggcttgtcaggtgaggattg-cccc 31485723  T
728 cacttataaa 737  Q
    ||||||||||    
31485724 cacttataaa 31485733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 79; E-Value: 2e-36
Query Start/End: Original strand, 550 - 739
Target Start/End: Original strand, 3519927 - 3520116
Alignment:
550 cctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagaga 649  Q
    |||||| |||||||||||||| ||||||||||||| |||||||||||||| |||||||||| ||||| |||||||||| |||||||||||| || ||||     
3519927 cctcacgaccagcactattgggcttggttcgtggacataaatggtgggtgtcccgatagcgaaaaccagatagcaggtggcccaatggatcatggagagg 3520026  T
650 ctcagatatcatcttagaactcgtggttgggcctaacacaaccc-cacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    ||| |||| || || |||| |||||||||  |||||||||||||  | ||||| || ||| ||| ||||||||| ||| ||||||||||||    
3520027 ctctgataccaactaagaaatcgtggttgaacctaacacaacccttataaaaccggcttgcgaggtgaggattg-cccccacttataaaca 3520116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 79; E-Value: 2e-36
Query Start/End: Original strand, 515 - 740
Target Start/End: Complemental strand, 21822035 - 21821813
Alignment:
515 catcttatattcgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaa 614  Q
    ||||| |||| |||||||| ||  |||| ||||| |||||| |||| |||||||   | ||||||||||| ||| ||||  | |||||| ||||||||||    
21822035 catctcatatccgatgtggaactgttaacacaccccctcacgaccaacactattatgcctggttcgtggacatatatgg--gatggcccaatagcggaaa 21821938  T
615 cctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagat 714  Q
    |||| |||||| | |||||| | ||||||||||| ||| |||| |||||||||| ||||||||||||||||||||| |||||||||  ||||||||||||    
21821937 cctgctagcagttggcccaacgtatcttgaagaggctctgataccatcttagaaatcgtggttgggcctaacacaatcccacaaaatcggtttgtgagat 21821838  T
715 gaggattgtccctcacttataaacat 740  Q
    || ||||| ||| ||||||| |||||    
21821837 gaagattg-cccccacttattaacat 21821813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 78; E-Value: 7e-36
Query Start/End: Original strand, 526 - 739
Target Start/End: Original strand, 2404273 - 2404484
Alignment:
526 cgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcag 625  Q
    ||||||||||| ||||| ||||| | |||| |||||||||||||  ||||||||||||| ||||| ||| ||||| || |||||||||||||||||||||    
2404273 cgatgtgggactcttaacacacctc-tcacgaccagcactattgcgcttggttcgtggacataaacggtaggtggtccaatagcggaaacctgatagcag 2404371  T
626 gtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtcc 725  Q
    ||  |||||||||| | |||||| ||| |||| |||||||||| ||||||||| || ||||||| ||| | ||||| |  ||||| | ||||||||| ||    
2404372 gtgacccaatggatttcgaagaggctctgataccatcttagaaatcgtggttgagcttaacacagccctataaaaccgacttgtggggtgaggattgccc 2404471  T
726 ctcacttataaaca 739  Q
    || |||||||||||    
2404472 ct-acttataaaca 2404484  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 75; E-Value: 4e-34
Query Start/End: Original strand, 522 - 700
Target Start/End: Original strand, 18826348 - 18826526
Alignment:
522 tattcgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgata 621  Q
    ||||||||||| ||| ||||| ||| | |||||  |||| ||| ||||| ||||||||||||  |||||||||||||||| ||||||||||||  |||||    
18826348 tattcgatgtgagactcttaacacatcccctcatgaccaacacaattgggcttggttcgtggtcataaatggtgggtggctcgatagcggaaatttgata 18826447  T
622 gcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaa 700  Q
    |||| | || || |||||||||||||| ||| ||||||||||||||| |  ||||||  ||||||||||||||||||||    
18826448 gcagatggctcagtggatcttgaagaggctctgatatcatcttagaaattatggttgaacctaacacaaccccacaaaa 18826526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 73; E-Value: 6e-33
Query Start/End: Original strand, 548 - 700
Target Start/End: Original strand, 36993194 - 36993346
Alignment:
548 cacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaaga 647  Q
    |||||||| ||||||||||||| ||||| |||||| | |||||| |||||||| || |||||||||| ||||||||| || |||||||||||||||||||    
36993194 cacctcacgaccagcactattgaacttgattcgtgaacataaatagtgggtggtccaatagcggaaatctgatagcacgtggcccaatggatcttgaaga 36993293  T
648 gactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaa 700  Q
    | ||| |||| |||||||||| || |||||||  |||||||||  ||||||||    
36993294 ggctctgataccatcttagaaatcatggttggatctaacacaattccacaaaa 36993346  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 72; E-Value: 3e-32
Query Start/End: Original strand, 526 - 625
Target Start/End: Original strand, 3519824 - 3519923
Alignment:
526 cgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcag 625  Q
    ||||||||||| ||||| ||||| |||||| ||||||| |||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
3519824 cgatgtgggactcttaacacaccccctcacgaccagcattattgggcttggttcgtggacataaatggtgggtggcccgatagcggaaacctgatagcag 3519923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 70; E-Value: 4e-31
Query Start/End: Original strand, 522 - 643
Target Start/End: Original strand, 2315121 - 2315242
Alignment:
522 tattcgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgata 621  Q
    ||||| ||||||||  ||||||||||| |||||| |||| ||||||||| ||||||||||||| ||||||||||||||| ||||| ||||||| ||||||    
2315121 tattcaatgtgggaatcttaatacaccccctcacgaccaacactattgggcttggttcgtggacataaatggtgggtggtccgattgcggaaatctgata 2315220  T
622 gcaggtagcccaatggatcttg 643  Q
    |||||| |||||||||| ||||    
2315221 gcaggtggcccaatggaccttg 2315242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 70; E-Value: 4e-31
Query Start/End: Original strand, 586 - 739
Target Start/End: Complemental strand, 34027553 - 34027401
Alignment:
586 ataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaa 685  Q
    |||||||  |||||||||||||  |||||||||||| ||||| |||||| | ||| ||||||| |||  ||| ||| |||||| ||||||||||||||||    
34027553 ataaatgacgggtggcccgataatggaaacctgataacaggtggcccaaagaatcgtgaagaggctctaataccatattagaaatcgtggttgggcctaa 34027454  T
686 cacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||||||||||| || ||||||| ||||||||| ||| ||||||||||||    
34027453 cacaaccccacaaaaccggcttgtgaggtgaggattg-cccccacttataaaca 34027401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 68; E-Value: 6e-30
Query Start/End: Original strand, 550 - 701
Target Start/End: Complemental strand, 28080863 - 28080709
Alignment:
550 cctcacaaccagcactattgga--cttggttcgtggaaataaatggtggg-tggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaag 646  Q
    |||||||| || |||||||||   ||||||||||| | ||||||| |||| || || |||||||||||| ||||||||||| ||||||| ||||||||||    
28080863 cctcacaatcaacactattgggggcttggttcgtgaacataaatgatggggtgaccagatagcggaaacttgatagcaggtggcccaatagatcttgaag 28080764  T
647 agactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaac 701  Q
    || ||| ||||||||||||||| ||||||||||  |||||| |||||||||||||    
28080763 aggctctgatatcatcttagaaatcgtggttggatctaacataaccccacaaaac 28080709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 573 - 739
Target Start/End: Original strand, 44874489 - 44874655
Alignment:
573 ttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcg 672  Q
    ||||||||| || ||||||| |||||| |||||| | ||||||||||||||||||  ||||||||||||||||||||||| |||| |||||||||  | |    
44874489 ttggttcgtagacataaatgatgggtgacccgattgtggaaacctgatagcaggtgacccaatggatcttgaagagactctgataccatcttagacattg 44874588  T
673 tggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    ||||| |||||||||||| |||| ||||  || ||||  | ||||||||||||  ||| ||||||||    
44874589 tggtttggcctaacacaagcccataaaatcggcttgtagggtgaggattgtcctccacgtataaaca 44874655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 65; E-Value: 4e-28
Query Start/End: Original strand, 515 - 679
Target Start/End: Original strand, 6001523 - 6001687
Alignment:
515 catcttatattcgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaa 614  Q
    |||||| ||| ||||||||||| ||||| ||||  |||||| ||||||| |||| | |||||||||||||||||||||||||| | | |||||| |||||    
6001523 catcttctatccgatgtgggactcttaacacactccctcacgaccagcattattaggcttggttcgtggaaataaatggtgggagactcgataggggaaa 6001622  T
615 cctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgg 679  Q
    ||||||||||| |  || |||  || |||||||| ||| |||| |||||||||| ||||||||||    
6001623 cctgatagcagatgacctaataaattttgaagaggctctgataccatcttagaaatcgtggttgg 6001687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 597 - 740
Target Start/End: Complemental strand, 10903234 - 10903092
Alignment:
597 gtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccac 696  Q
    |||| |||||||||||||| ||||| ||||| ||||||||||||||| |||  ||| |||||||| |||| | ||||||||||| |||||||||| ||||    
10903234 gtggtccgatagcggaaacatgataacaggtggcccaatggatcttggagaagctctgatatcattttagtaatcgtggttggggctaacacaactccac 10903135  T
697 aaaactggtttgtgagatgaggattgtccctcacttataaacat 740  Q
    ||||| || ||||||| ||||||||  |||| ||||||||||||    
10903134 aaaaccggcttgtgaggtgaggattacccct-acttataaacat 10903092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 63; E-Value: 6e-27
Query Start/End: Original strand, 559 - 739
Target Start/End: Original strand, 48417411 - 48417591
Alignment:
559 cagcactattggacttggttcgtggaa-ataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaaga-gactcagat 656  Q
    |||||||||||| |||||| | ||| | ||||||||||| || |||||||||||||||  |||||||||| ||||||||||||  | ||| | |||  ||    
48417411 cagcactattgggcttggtgcatgggatataaatggtggttg-cccgatagcggaaacaagatagcaggtggcccaatggatcaaggagaaggctctaat 48417509  T
657 atcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    | ||||| |||| | ||||||||||||||||||||||||||||||||||||||||| | | ||||| | ||||||||||||||    
48417510 accatctaagaaattgtggttgggcctaacacaaccccacaaaactggtttgtgaggtcaagattg-ctctcacttataaaca 48417591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 586 - 739
Target Start/End: Original strand, 26561997 - 26562149
Alignment:
586 ataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaa 685  Q
    ||||||| |||||| || |||| ||||||||||||| ||||| |||||| | ||| ||||||||||| |||| ||| |||||| | ||||||| ||||||    
26561997 ataaatgatgggtgacctgataacggaaacctgataacaggtggcccaaagaatcgtgaagagactctgataccatattagaaatggtggttgagcctaa 26562096  T
686 cacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    || ||||||||||||| || ||||||| ||| ||||| ||| ||||||||||||    
26562097 cataaccccacaaaaccggcttgtgaggtgaagattg-cccccacttataaaca 26562149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 61; E-Value: 9e-26
Query Start/End: Original strand, 526 - 634
Target Start/End: Original strand, 40746132 - 40746239
Alignment:
526 cgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcag 625  Q
    ||||||||||| ||||| ||||| |||||| |||||||||||||| ||||||||||||| |||||||||||||||  ||||| || ||||||||||||||    
40746132 cgatgtgggactcttaacacacc-cctcacgaccagcactattgggcttggttcgtggacataaatggtgggtggttcgataacgaaaacctgatagcag 40746230  T
626 gtagcccaa 634  Q
    || ||||||    
40746231 gtggcccaa 40746239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #28
Raw Score: 60; E-Value: 4e-25
Query Start/End: Original strand, 586 - 737
Target Start/End: Original strand, 31257191 - 31257341
Alignment:
586 ataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaa 685  Q
    |||||||  ||||||||||||| ||||||||||||| ||| | |||||| | ||| ||||||  ||| |||| ||| |||||| ||||||||||||||||    
31257191 ataaatgacgggtggcccgataacggaaacctgataacagatggcccaaagaatcgtgaagaagctctgataccatattagaaatcgtggttgggcctaa 31257290  T
686 cacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaa 737  Q
    |||||||||||||||| || ||||||  | ||||||| ||| ||||||||||    
31257291 cacaaccccacaaaaccggcttgtgaattaaggattg-cccccacttataaa 31257341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #29
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 586 - 739
Target Start/End: Original strand, 2544373 - 2544523
Alignment:
586 ataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaa 685  Q
    |||||||  ||||||| ||||| ||||||||| ||| ||||| |||||| | ||| ||||||||||  |||| ||| ||| || ||||||||||||||||    
2544373 ataaatgacgggtggctcgataacggaaacctaataacaggtggcccaaagaatcgtgaagagact--gataccatattaaaaatcgtggttgggcctaa 2544470  T
686 cacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||||||||||| |  ||||||| ||||||||| ||| ||||||||||||    
2544471 cacaaccccacaaaaccgacttgtgaggtgaggattg-cccccacttataaaca 2544523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #30
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 633 - 739
Target Start/End: Original strand, 3038055 - 3038160
Alignment:
633 aatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcactt 732  Q
    |||||||||||||||| ||| ||||| ||||||||| || ||||||||||||||||||||||||||||| || ||||||  ||||||||| ||| |||||    
3038055 aatggatcttgaagaggctctgatattatcttagaaatcatggttgggcctaacacaaccccacaaaaccggcttgtgacgtgaggattg-cccccactt 3038153  T
733 ataaaca 739  Q
    |||||||    
3038154 ataaaca 3038160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #31
Raw Score: 58; E-Value: 6e-24
Query Start/End: Original strand, 573 - 722
Target Start/End: Complemental strand, 4507105 - 4506956
Alignment:
573 ttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcg 672  Q
    |||||| ||||| |||| |||| ||||| | |||| |||||| ||||||||||||  |||||||||||||||| || ||| ||||  ||||||||| |||    
4507105 ttggtttgtggacataactggttggtggtctgataacggaaatctgatagcaggtgacccaatggatcttgaaaaggctctgatacaatcttagaaatcg 4507006  T
673 tggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattg 722  Q
    | |||||| |||||||||||||| ||||| |  ||||||| |||||||||    
4507005 tagttgggtctaacacaaccccataaaaccgacttgtgaggtgaggattg 4506956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #32
Raw Score: 58; E-Value: 6e-24
Query Start/End: Original strand, 572 - 678
Target Start/End: Complemental strand, 20305468 - 20305358
Alignment:
572 cttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagc----ccaatggatcttgaagagactcagatatcatcttaga 667  Q
    ||||||||||||| |||||||||||||||||||||||||||||||||||||||| |  |    |||||||||||||||||| ||| |||| ||||||| |    
20305468 cttggttcgtggacataaatggtgggtggcccgatagcggaaacctgatagcagatgacccatccaatggatcttgaagaggctctgataccatcttaaa 20305369  T
668 actcgtggttg 678  Q
    | |||||||||    
20305368 aatcgtggttg 20305358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #33
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 602 - 698
Target Start/End: Original strand, 10882179 - 10882275
Alignment:
602 ccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaa 698  Q
    |||||| ||||||||||||| ||||| |||||| | ||| ||||||| ||| |||| |||||||||| |||||||||||||||||||||||||||||    
10882179 ccgataacggaaacctgataacaggtggcccaaagaatcgtgaagaggctctgataccatcttagaaatcgtggttgggcctaacacaaccccacaa 10882275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #34
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 604 - 739
Target Start/End: Original strand, 26239857 - 26239992
Alignment:
604 gatagcggaaacctgatagcaggtagcccaatggatcttgaag-agactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaact 702  Q
    |||| ||||||||||||||||||| |||||| |||||||| || || ||| |||| |||||||||| | ||||||||| ||||||||||||||||| ||     
26239857 gataacggaaacctgatagcaggtggcccaacggatcttggaggaggctctgataccatcttagaaattgtggttgggtctaacacaaccccacaatacc 26239956  T
703 ggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |  ||||||| ||||||||| ||| ||||||||||||    
26239957 gacttgtgaggtgaggattg-cccccacttataaaca 26239992  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #35
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 539 - 722
Target Start/End: Original strand, 30727231 - 30727415
Alignment:
539 ttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatgga 638  Q
    |||| ||||| ||||||  ||| ||||||||| ||| ||| ||||| |||||||||||||||||| |||||||||||||||||| |||| ||||||   |    
30727231 ttaacacaccccctcacgcccaacactattgggcttagtttgtggatataaatggtgggtggcccaatagcggaaacctgatagaaggtggcccaacaaa 30727330  T
639 tctt-gaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattg 722  Q
    |||| ||  |||||| |||| ||||||| || |  |||| ||| ||||| ||||| |||||||| || ||||||| |||||||||    
30727331 tcttggattagactctgataccatcttaaaaattctggtcgggactaactcaacctcacaaaaccggcttgtgaggtgaggattg 30727415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #36
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 526 - 692
Target Start/End: Original strand, 9688969 - 9689130
Alignment:
526 cgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcag 625  Q
    |||||||| || ||||| || || |||||| | || ||||||||| |||||||||||| | ||||| ||||||||||    |||||||||||||||||||    
9688969 cgatgtggaactcttaacaccccccctcacgatcaacactattgggcttggttcgtggca-taaatcgtgggtggcc----agcggaaacctgatagcag 9689063  T
626 gtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaacc 692  Q
    || | ||||||||||||| |||| ||| |||| ||| | |||| | |||||||||||||||| ||||    
9689064 gtggtccaatggatcttggagaggctctgataccatatcagaaattgtggttgggcctaacaaaacc 9689130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #37
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 586 - 739
Target Start/End: Complemental strand, 40746425 - 40746273
Alignment:
586 ataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaa 685  Q
    |||||||  ||||||||||||| ||||||||||||| ||| |  ||||| |  || ||||||| |||  ||| ||| |||||| | ||||||||||||||    
40746425 ataaatgacgggtggcccgataacggaaacctgataacagttgccccaaagattcgtgaagaggctctaataccatattagaaattgtggttgggcctaa 40746326  T
686 cacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||||||||||  || || |||| ||||||||| ||||||||||||||||    
40746325 cacaaccccacaaaatcggcttatgaggtgaggattg-ccctcacttataaaca 40746273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #38
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 544 - 702
Target Start/End: Original strand, 5871693 - 5871852
Alignment:
544 acaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttg 643  Q
    ||||| |||||| |||||||||||||   ||||||||| || ||||||||| ||| | ||||||||  |||  |||||| ||||  | |||||||||||     
5871693 acaccccctcacgaccagcactattgagtttggttcgttgacataaatggtaggtcgtccgatagcaaaaatatgatagtaggtgactcaatggatctta 5871792  T
644 aag-agactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaact 702  Q
    | | || ||| ||||||||||||||| ||||||||||| |||||||||||| ||||||||    
5871793 acggaggctctgatatcatcttagaaatcgtggttgggactaacacaaccctacaaaact 5871852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #39
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 660 - 739
Target Start/End: Complemental strand, 47710529 - 47710451
Alignment:
660 atcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    ||||||||| | ||||||||||||||||||||||||||||||||| ||||||| ||||||||| ||| ||||||||||||    
47710529 atcttagaaatggtggttgggcctaacacaaccccacaaaactggcttgtgaggtgaggattg-cccccacttataaaca 47710451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #40
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 660 - 739
Target Start/End: Complemental strand, 47722185 - 47722107
Alignment:
660 atcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    ||||||||| | ||||||||||||||||||||||||||||||||| ||||||| ||||||||| ||| ||||||||||||    
47722185 atcttagaaatggtggttgggcctaacacaaccccacaaaactggcttgtgaggtgaggattg-cccccacttataaaca 47722107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #41
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 629 - 739
Target Start/End: Complemental strand, 17202296 - 17202187
Alignment:
629 gcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctc 728  Q
    |||||| | ||| ||||||| ||| |||| ||| ||| || |||||||||||||||||||||||||||||||| || |||||||||||| |||| ||| |    
17202296 gcccaaagaatcatgaagaggctctgataccatattaaaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgagatgagaattg-ccccc 17202198  T
729 acttataaaca 739  Q
    |||||||||||    
17202197 acttataaaca 17202187  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #42
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 562 - 719
Target Start/End: Complemental strand, 32292703 - 32292546
Alignment:
562 cactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatctt-gaagagactcagatatca 660  Q
    ||||||||| |||||| |||||| ||| |||||||||| |||||||||| ||||||||||| ||||  ||| || | |||| || ||||||  |||| ||    
32292703 cactattgggcttggtgcgtggatatatatggtgggtgacccgatagcgaaaacctgatagaaggtgacccgataggtcttggaggagacttggatacca 32292604  T
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgagga 719  Q
    |||||||| |  ||||||||||| ||||||||||||||| | || ||||||| ||||||    
32292603 tcttagaatttttggttgggcct-acacaaccccacaaatccggcttgtgaggtgagga 32292546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #43
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 439 - 516
Target Start/End: Complemental strand, 25620221 - 25620144
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| |||| ||||| | |||||||||||||||||||||| ||||||| || ||||||||||||||||||||||    
25620221 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaaca 25620144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #44
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 660 - 740
Target Start/End: Original strand, 21054951 - 21055030
Alignment:
660 atcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaacat 740  Q
    ||||||||| | |||||||||||||||||||||||||||||| || ||||||| ||||||||| ||| |||||||||||||    
21054951 atcttagaaatggtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattg-cccccacttataaacat 21055030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #45
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 659 - 739
Target Start/End: Original strand, 32879611 - 32879691
Alignment:
659 catcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||||| |||| |||||||||||||||||||| |||||| || ||||||| ||||||||| ||| ||||||||||||    
32879611 catcttagaagtcgtcgttgggcctaacacaaccccgcaaaaccggcttgtgaggtgaggattgccccccacttataaaca 32879691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #46
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 441 - 516
Target Start/End: Complemental strand, 34027476 - 34027401
Alignment:
441 ttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||| |||| ||||| | |||||||||||||||||||||| ||||||| || ||||||||||||||||||||||    
34027476 ttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaaca 34027401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #47
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 439 - 517
Target Start/End: Original strand, 21054952 - 21055030
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaacat 517  Q
    |||||||| | || ||||| | |||||||||||||||||||||| ||||||| || |||||||||||||||||||||||    
21054952 tcttagaaatggtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacat 21055030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #48
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 439 - 584
Target Start/End: Original strand, 48243060 - 48243216
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaacatctt-----------atattcg 527  Q
    ||||| || |||| ||||| | |||||||||||||||||||||| ||||||| || ||||||||||||||||||||||  ||           ||||  |    
48243060 tcttacaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcagaccatcatatctg 48243159  T
528 atgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtgga 584  Q
    ||||||||| ||||| ||||| |||||| |||||||||||||  |||||||||||||    
48243160 atgtgggactcttaacacaccccctcacgaccagcactattgagcttggttcgtgga 48243216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #49
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 661 - 739
Target Start/End: Original strand, 48243060 - 48243137
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    ||||| || |||||||||||||||||||||||||||||||| || ||||||| ||||||||| ||| ||||||||||||    
48243060 tcttacaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgaggattg-cccccacttataaaca 48243137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #50
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 586 - 739
Target Start/End: Original strand, 32278995 - 32279142
Alignment:
586 ataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaa 685  Q
    ||||||||||| ||||||||||||| |||||||||||||||| |||||||  || ||| |||| ||| ||||||     | || | |||||||||| |||    
32278995 ataaatggtggatggcccgatagcgaaaacctgatagcaggtggcccaataaattttggagaggctctgatatc-----aaaaatggtggttgggcataa 32279089  T
686 cacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||| | | |||||||||| |||| || |||||||||| || ||||||||||||    
32279090 cacagctctacaaaactggcttgttaggtgaggattgt-ccacacttataaaca 32279142  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #51
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 448 - 516
Target Start/End: Complemental strand, 17202255 - 17202187
Alignment:
448 tcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||| ||||| | |||||||||||||||||||||| |||||||||| | ||||||||||||||||||||    
17202255 tcgtggttgggcctaacacaaccccacaaaaccggcttgtgagatgagaattgcccccacttataaaca 17202187  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #52
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 663 - 739
Target Start/End: Original strand, 31257032 - 31257107
Alignment:
663 ttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||| ||||||||| | ||||||||||||||||||||||||||||||| ||| ||||| ||| ||||||||||||    
31257032 ttagaaatcgtggttgagtctaacacaaccccacaaaactggtttgtgaggtgaagattg-cccccacttataaaca 31257107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #53
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 647 - 739
Target Start/End: Original strand, 48243422 - 48243513
Alignment:
647 agactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||| |||| ||||||| || || |||||||| |||||||||||||||||||| || |||| |||||||||||| ||| ||||||||||||    
48243422 agactctgataccatcttaaaaatcatggttgggtctaacacaaccccacaaaaccggcttgtaagatgaggattg-cccccacttataaaca 48243513  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #54
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 441 - 516
Target Start/End: Complemental strand, 29469688 - 29469613
Alignment:
441 ttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||| |||| ||||| | |||||||||||||||||||||| |||| || || ||||||||||||||||||||||    
29469688 ttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtaaggtgaggattgcccccacttataaaca 29469613  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #55
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 461 - 516
Target Start/End: Original strand, 48243458 - 48243513
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||||||||||||||||| |||| ||||| ||||||||||||||||||||||    
48243458 taacacaaccccacaaaaccggcttgtaagatgaggattgcccccacttataaaca 48243513  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #56
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 661 - 739
Target Start/End: Complemental strand, 6634940 - 6634863
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||| || |||||||||||||||||||||||||||||| | || |||| ||||||||| ||| ||||||||||||    
6634940 tcttagaaatcatggttgggcctaacacaaccccacaaaactagcttatgaggtgaggattg-cccccacttataaaca 6634863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #57
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 673 - 739
Target Start/End: Complemental strand, 15317625 - 15317560
Alignment:
673 tggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    ||||||||||||||||||| |||||||||| ||||||||| ||||||||| ||| ||||||||||||    
15317625 tggttgggcctaacacaacaccacaaaactagtttgtgaggtgaggattg-cccccacttataaaca 15317560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #58
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 439 - 517
Target Start/End: Complemental strand, 21821891 - 21821813
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaacat 517  Q
    |||||||| |||| ||||| | |||||||| ||||||||| ||||||||||||||  |||||||||||||||| |||||    
21821891 tcttagaaatcgtggttgggcctaacacaatcccacaaaatcggtttgtgagatgaagattgcccccacttattaacat 21821813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #59
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 661 - 739
Target Start/End: Complemental strand, 34027712 - 34027635
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||| ||||| |||||||||||||||||||||||||| || ||||||  ||||||||| ||| ||||||||||||    
34027712 tcttagaaatcgtgattgggcctaacacaaccccacaaaaccggcttgtgaagtgaggattg-cccccacttataaaca 34027635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #60
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 439 - 516
Target Start/End: Original strand, 3038083 - 3038160
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| || | ||||| | |||||||||||||||||||||| ||||||  || ||||||||||||||||||||||    
3038083 tcttagaaatcatggttgggcctaacacaaccccacaaaaccggcttgtgacgtgaggattgcccccacttataaaca 3038160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #61
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 560 - 680
Target Start/End: Original strand, 5871853 - 5871974
Alignment:
560 agcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaag-agactcagatat 658  Q
    ||||||||||   ||||||||| || ||||||||| ||| | |||||||||||||  |||||||||||  | ||||||||||| | | || ||| |||||    
5871853 agcactattgagtttggttcgttgacataaatggtaggtcgtccgatagcggaaatatgatagcaggtgactcaatggatcttaacgcaggctctgatat 5871952  T
659 catcttagaactcgtggttggg 680  Q
    |||||||||| |||||||||||    
5871953 catcttagaaatcgtggttggg 5871974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #62
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 439 - 516
Target Start/End: Complemental strand, 34027712 - 34027635
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| ||||  |||| | |||||||||||||||||||||| ||||||  || ||||||||||||||||||||||    
34027712 tcttagaaatcgtgattgggcctaacacaaccccacaaaaccggcttgtgaagtgaggattgcccccacttataaaca 34027635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #63
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 439 - 516
Target Start/End: Original strand, 43085536 - 43085613
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| |||| ||||  ||||||||||||||||||||||   ||||||| || ||||||||||||||||||||||    
43085536 tcttagaaatcgtggttgagcttaacacaaccccacaaaaccaacttgtgaggtgaggattgcccccacttataaaca 43085613  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #64
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 439 - 516
Target Start/End: Complemental strand, 47710528 - 47710451
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| | || ||||| | ||||||||||||||||||| || ||||||| || ||||||||||||||||||||||    
47710528 tcttagaaatggtggttgggcctaacacaaccccacaaaactggcttgtgaggtgaggattgcccccacttataaaca 47710451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #65
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 439 - 516
Target Start/End: Complemental strand, 47722184 - 47722107
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| | || ||||| | ||||||||||||||||||| || ||||||| || ||||||||||||||||||||||    
47722184 tcttagaaatggtggttgggcctaacacaaccccacaaaactggcttgtgaggtgaggattgcccccacttataaaca 47722107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #66
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 448 - 516
Target Start/End: Original strand, 2544455 - 2544523
Alignment:
448 tcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||| ||||| | |||||||||||||||||||||  ||||||| || ||||||||||||||||||||||    
2544455 tcgtggttgggcctaacacaaccccacaaaaccgacttgtgaggtgaggattgcccccacttataaaca 2544523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #67
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 663 - 739
Target Start/End: Complemental strand, 29469923 - 29469848
Alignment:
663 ttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||| |||||||||||||||||||||| ||||||||| || |||| || ||||||||| ||| ||||||||||||    
29469923 ttagaaatcgtggttgggcctaacacaactccacaaaaccggcttgtaaggtgaggattg-cccccacttataaaca 29469848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #68
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 663 - 739
Target Start/End: Complemental strand, 40746581 - 40746506
Alignment:
663 ttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||| || |||||||||||||||||||| ||||||||||| ||||||| || ||||| |||| ||||||||||||    
40746581 ttagaaatcatggttgggcctaacacaacctcacaaaactggcttgtgaggtgtggatt-tcccccacttataaaca 40746506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #69
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 441 - 516
Target Start/End: Complemental strand, 29469923 - 29469848
Alignment:
441 ttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||| |||| ||||| | ||||||||| |||||||||||| |||| || || ||||||||||||||||||||||    
29469923 ttagaaatcgtggttgggcctaacacaactccacaaaaccggcttgtaaggtgaggattgcccccacttataaaca 29469848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #70
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 461 - 516
Target Start/End: Original strand, 31257052 - 31257107
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    ||||||||||||||||||| |||||||||| ||  |||||||||||||||||||||    
31257052 taacacaaccccacaaaactggtttgtgaggtgaagattgcccccacttataaaca 31257107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #71
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 654 - 701
Target Start/End: Original strand, 40121916 - 40121963
Alignment:
654 gatatcatcttagaactcgtggttgggcctaacacaaccccacaaaac 701  Q
    |||| |||||||||| ||||||||||||||||||||||||||||||||    
40121916 gataccatcttagaaatcgtggttgggcctaacacaaccccacaaaac 40121963  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #72
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 664 - 739
Target Start/End: Original strand, 44874348 - 44874422
Alignment:
664 tagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    ||||| |||||||||||||||||||||||  ||||||  |||||||||| |||||||| |||| ||||||||||||    
44874348 tagaaatcgtggttgggcctaacacaaccatacaaaatcggtttgtgaggtgaggatt-tcccccacttataaaca 44874422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #73
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 633 - 711
Target Start/End: Complemental strand, 11743141 - 11743063
Alignment:
633 aatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtga 711  Q
    |||||||||||||||| ||| |||||||||||| || ||||||||  | |||||||||  ||||||||| |||||||||    
11743141 aatggatcttgaagaggctctgatatcatcttaaaaatcgtggttaagtctaacacaattccacaaaaccggtttgtga 11743063  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #74
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 661 - 739
Target Start/End: Complemental strand, 21861614 - 21861537
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||| | |||||||||||||||||||||||||||||  || |||| || ||||||||| ||| ||||||||||||    
21861614 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtaaggtgaggattg-cccccacttataaaca 21861537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #75
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 439 - 516
Target Start/End: Original strand, 32879613 - 32879691
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattg-cccccacttataaaca 516  Q
    |||||||| |||| ||||| | |||||||||||| ||||||||| ||||||| || |||||| ||||||||||||||||    
32879613 tcttagaagtcgtcgttgggcctaacacaaccccgcaaaaccggcttgtgaggtgaggattgccccccacttataaaca 32879691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #76
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 670 - 739
Target Start/End: Original strand, 2544223 - 2544291
Alignment:
670 tcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    ||||||| ||||||||||||||||||||||||||| |||| || ||| ||||| ||| ||||||||||||    
2544223 tcgtggtagggcctaacacaaccccacaaaactggcttgtaaggtgaagattg-cccccacttataaaca 2544291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #77
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 467 - 516
Target Start/End: Original strand, 10882032 - 10882081
Alignment:
467 aaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||||||||||| ||||||| || ||||||||||||||||||||||    
10882032 aaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaaca 10882081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #78
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 654 - 739
Target Start/End: Original strand, 20305655 - 20305739
Alignment:
654 gatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||| ||| |||||| || ||||| ||||||||||||||||||||||   ||||||||| ||||||||| ||| ||||||||||||    
20305655 gatagcatattagaaatcatggttaggcctaacacaaccccacaaaataagtttgtgaggtgaggattg-cccccacttataaaca 20305739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #79
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 439 - 516
Target Start/End: Complemental strand, 21861614 - 21861537
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| | || ||||| | |||||||||||||||||| ||| |||| || || ||||||||||||||||||||||    
21861614 tcttagaaatggtggttgggcctaacacaaccccacaaaatcggcttgtaaggtgaggattgcccccacttataaaca 21861537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #80
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 562 - 726
Target Start/End: Original strand, 22339503 - 22339667
Alignment:
562 cactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaag-agactcagatatca 660  Q
    ||||||||| ||| ||||||||| || |||||||| |||  |||||| | ||||||| |||||||| | |||||||||||| | | || ||| |||| ||    
22339503 cactattgggctttgttcgtggacattaatggtgg-tgggtcgatagagaaaacctggtagcaggtggtccaatggatcttaacggaggctctgatacca 22339601  T
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccc 726  Q
    | |||||| | || ||||||||||||||||||  |  |||| || ||||||| | |||||||||||    
22339602 tattagaaattgtcgttgggcctaacacaacctaaataaaccggcttgtgaggttaggattgtccc 22339667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #81
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 441 - 514
Target Start/End: Original strand, 31257268 - 31257341
Alignment:
441 ttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaa 514  Q
    |||||| |||| ||||| | |||||||||||||||||||||| ||||||  |  ||||||||||||||||||||    
31257268 ttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaattaaggattgcccccacttataaa 31257341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #82
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 439 - 516
Target Start/End: Original strand, 36277225 - 36277302
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| |||| |||||   |||||||||||||||||| ||  ||||||| || ||||||||||||||||||||||    
36277225 tcttagaaatcgtggttgggactaacacaaccccacaaaatcgacttgtgaggtgaggattgcccccacttataaaca 36277302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #83
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 439 - 516
Target Start/End: Original strand, 43075309 - 43075386
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| |||| ||||  || |||||||||||||||||||   ||||||| || ||||||||||||||||||||||    
43075309 tcttagaaatcgtggttgagctcaacacaaccccacaaaaccaacttgtgaggtgaggattgcccccacttataaaca 43075386  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #84
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 654 - 722
Target Start/End: Complemental strand, 6782953 - 6782885
Alignment:
654 gatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattg 722  Q
    |||| ||| |||||| ||||||||| |||||||||||||||||||||| || |||| || |||||||||    
6782953 gataccatgttagaaatcgtggttgagcctaacacaaccccacaaaaccggcttgtaaggtgaggattg 6782885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #85
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 663 - 739
Target Start/End: Original strand, 10882007 - 10882081
Alignment:
663 ttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||| |||||||||||||||| | ||||||||||||| || ||||||| ||||||||| ||| ||||||||||||    
10882007 ttagaaatcgtggttgggcctaata-aaccccacaaaaccggcttgtgaggtgaggattg-cccccacttataaaca 10882081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #86
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 670 - 722
Target Start/End: Original strand, 11211687 - 11211739
Alignment:
670 tcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattg 722  Q
    ||||||||||||| |||||||||||||||||| || ||||||| |||||||||    
11211687 tcgtggttgggcccaacacaaccccacaaaaccggcttgtgaggtgaggattg 11211739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #87
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 461 - 513
Target Start/End: Original strand, 14540973 - 14541025
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataa 513  Q
    |||||||||||||||||||||  || |||| ||||||||||||||||||||||    
14540973 taacacaaccccacaaaaccgacttatgaggtgtggattgcccccacttataa 14541025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #88
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 537 - 621
Target Start/End: Complemental strand, 17948444 - 17948360
Alignment:
537 gcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgata 621  Q
    |||||| ||||||| |||| || || |||||||| ||||||| ||||| | ||||||||||||| | ||||||||||| ||||||    
17948444 gcttaacacaccacttcacgactagtactattgggcttggtttgtggacacaaatggtgggtggtctgatagcggaaatctgata 17948360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #89
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 661 - 737
Target Start/End: Complemental strand, 22574920 - 22574845
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaa 737  Q
    |||||||| ||||||||||||||||||||| | ||||||   || ||||||| ||||||||| ||||||||||||||    
22574920 tcttagaaatcgtggttgggcctaacacaaactcacaaatacggcttgtgaggtgaggattg-ccctcacttataaa 22574845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #90
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 436 - 516
Target Start/End: Original strand, 44874342 - 44874422
Alignment:
436 aagtcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    ||||| ||||| |||| ||||| | ||||||||||  |||||| ||||||||||| || ||||| ||||||||||||||||    
44874342 aagtcatagaaatcgtggttgggcctaacacaaccatacaaaatcggtttgtgaggtgaggatttcccccacttataaaca 44874422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #91
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 586 - 740
Target Start/End: Complemental strand, 1793908 - 1793753
Alignment:
586 ataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttga---agagactcagatatcatcttagaactcgtggttgggcc 682  Q
    |||||||||||||||||| | | ||||||||||||||||||| ||||||   ||||||    ||  | | | ||| |||||| ||| |||||||||||||    
1793908 ataaatggtgggtggcccaacaacggaaacctgatagcaggtggcccaaca-atcttggtggaggcaatgatataccatcttcgaaatcgtggttgggcc 1793810  T
683 taacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaacat 740  Q
    |  ||||||||||||||||  | ||||||| ||||||||| ||| |||| ||||||||    
1793809 ttgcacaaccccacaaaacctgcttgtgaggtgaggattg-cccccactaataaacat 1793753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #92
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 663 - 718
Target Start/End: Complemental strand, 1794003 - 1793948
Alignment:
663 ttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgagg 718  Q
    |||||| ||||||||||||| ||||||||| ||||||||||| ||||||| |||||    
1794003 ttagaaatcgtggttgggcccaacacaaccgcacaaaactggcttgtgaggtgagg 1793948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #93
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 672 - 739
Target Start/End: Complemental strand, 3393056 - 3392990
Alignment:
672 gtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||||||||||||||||||||||||  || ||||||| |||| ||| |||| ||||||||||||    
3393056 gtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgagaattttccc-cacttataaaca 3392990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #94
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 595 - 690
Target Start/End: Complemental strand, 4268007 - 4267912
Alignment:
595 gggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaa 690  Q
    ||||||||||||| ||||||| ||||| ||||| |||||| | ||| |||| ||  |  |||| ||||||| || |||||||||||||||||||||    
4268007 gggtggcccgataacggaaacatgataacaggtggcccaaagaatcgtgaaaaggttttgataccatcttaaaaatcgtggttgggcctaacacaa 4267912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #95
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 473 - 516
Target Start/End: Complemental strand, 4454827 - 4454784
Alignment:
473 acaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||||||||||||| || ||||||||||||||||||||||    
4454827 acaaaaccggtttgtgaggtgaggattgcccccacttataaaca 4454784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #96
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 461 - 516
Target Start/End: Complemental strand, 15317615 - 15317560
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    ||||||||| |||||||||  ||||||||| || ||||||||||||||||||||||    
15317615 taacacaacaccacaaaactagtttgtgaggtgaggattgcccccacttataaaca 15317560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #97
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 461 - 516
Target Start/End: Original strand, 20305684 - 20305739
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    ||||||||||||||||||   ||||||||| || ||||||||||||||||||||||    
20305684 taacacaaccccacaaaataagtttgtgaggtgaggattgcccccacttataaaca 20305739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #98
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 461 - 516
Target Start/End: Original strand, 23839098 - 23839153
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||||| ||||||||||| ||||||| || ||||| ||||||||||||||||    
23839098 taacacaacctcacaaaaccggcttgtgaggtgaggatttcccccacttataaaca 23839153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #99
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 461 - 516
Target Start/End: Original strand, 26239937 - 26239992
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||||||||||| ||||  ||||||| || ||||||||||||||||||||||    
26239937 taacacaaccccacaataccgacttgtgaggtgaggattgcccccacttataaaca 26239992  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #100
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 461 - 516
Target Start/End: Original strand, 26562094 - 26562149
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    ||||| |||||||||||||||| ||||||| ||  |||||||||||||||||||||    
26562094 taacataaccccacaaaaccggcttgtgaggtgaagattgcccccacttataaaca 26562149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #101
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 461 - 516
Target Start/End: Original strand, 31485445 - 31485500
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||||| ||||||||| ||||||||  || ||||||||||||||||||||||    
31485445 taacacaacctcacaaaaccagtttgtgatgtgaggattgcccccacttataaaca 31485500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #102
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 439 - 514
Target Start/End: Original strand, 33996310 - 33996385
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaa 514  Q
    |||||||| |||| ||||| | ||||||||| |||||||||||  ||||||| ||  |||||||||||||||||||    
33996310 tcttagaaatcgtggttgggcctaacacaactccacaaaaccgacttgtgaggtgaagattgcccccacttataaa 33996385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #103
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 660 - 739
Target Start/End: Original strand, 36276989 - 36277067
Alignment:
660 atcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    ||||||||| |||||||| |||||||||||| |||| |||||  | ||||||| |||| |||||||| ||||||||||||    
36276989 atcttagaaatcgtggttaggcctaacacaatcccataaaacctgcttgtgaggtgagaattgtccc-cacttataaaca 36277067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #104
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 660 - 739
Target Start/End: Original strand, 36993072 - 36993150
Alignment:
660 atcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    ||||||||| || |||||||||||||||||||||||||||||  | ||||||| |||| ||||  ||| |||||||||||    
36993072 atcttagaaatcatggttgggcctaacacaaccccacaaaaccagcttgtgaggtgagcattgctcct-acttataaaca 36993150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #105
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 461 - 516
Target Start/End: Complemental strand, 40746561 - 40746506
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||||| |||||||| || ||||||| |||||||| ||||||||||||||||    
40746561 taacacaacctcacaaaactggcttgtgaggtgtggatttcccccacttataaaca 40746506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #106
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 453 - 516
Target Start/End: Original strand, 40898728 - 40898791
Alignment:
453 gttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||  |||||||| |||||||| |||||||| || || ||||||||||||||||||||||    
40898728 gttggaccaaacacaactccacaaaatcggtttgtaaggtgaggattgcccccacttataaaca 40898791  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #107
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 461 - 516
Target Start/End: Complemental strand, 47849634 - 47849579
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| ||||||||||||| ||||||| || |||||||||| |||||||||||    
47849634 taacacaagcccacaaaaccgggttgtgaggtgaggattgccccaacttataaaca 47849579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #108
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 672 - 739
Target Start/End: Complemental strand, 47849864 - 47849798
Alignment:
672 gtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    ||||||||||||| ||||||||||||||||||| ||||||| |||| |||| |||  |||||||||||    
47849864 gtggttgggcctagcacaaccccacaaaactggcttgtgaggtgagtattg-ccccaacttataaaca 47849798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #109
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 659 - 737
Target Start/End: Complemental strand, 1596915 - 1596838
Alignment:
659 catcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaa 737  Q
    |||||||| | | |||||||||||||||||||||| ||||||| || |||| || ||||||||| ||| ||||||||||    
1596915 catcttagtaattgtggttgggcctaacacaaccctacaaaaccggcttgtaaggtgaggattg-cccccacttataaa 1596838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #110
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 661 - 739
Target Start/End: Complemental strand, 6991840 - 6991763
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||| | ||||||||||||||||||||| || |||||||| ||  ||| ||||||||||| | ||||||||||||    
6991840 tcttagaaattgtggttgggcctaacacaacctcataaaactggcttaagaggtgaggattgtcgc-cacttataaaca 6991763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #111
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 677 - 739
Target Start/End: Original strand, 23839092 - 23839153
Alignment:
677 tgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||||||||||| |||||||| || ||||||| |||||||| |||| ||||||||||||    
23839092 tgggcctaacacaacctcacaaaaccggcttgtgaggtgaggatt-tcccccacttataaaca 23839153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #112
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 661 - 739
Target Start/End: Original strand, 43085536 - 43085613
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||| ||||||||| || |||||||||||||||||||    ||||||| ||||||||| ||| ||||||||||||    
43085536 tcttagaaatcgtggttgagcttaacacaaccccacaaaaccaacttgtgaggtgaggattg-cccccacttataaaca 43085613  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #113
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 462 - 516
Target Start/End: Original strand, 43089230 - 43089284
Alignment:
462 aacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||||||||||||||   ||||||| || ||||||||||||||||||||||    
43089230 aacacaaccccacaaaaccaacttgtgaggtgaggattgcccccacttataaaca 43089284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #114
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 661 - 699
Target Start/End: Original strand, 43688159 - 43688197
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaa 699  Q
    |||||||| ||||||||||||||||||||||||||||||    
43688159 tcttagaaatcgtggttgggcctaacacaaccccacaaa 43688197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #115
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 461 - 514
Target Start/End: Complemental strand, 1596891 - 1596838
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaa 514  Q
    ||||||||||| |||||||||| |||| || || ||||||||||||||||||||    
1596891 taacacaaccctacaaaaccggcttgtaaggtgaggattgcccccacttataaa 1596838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #116
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 464 - 517
Target Start/End: Complemental strand, 1793806 - 1793753
Alignment:
464 cacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaacat 517  Q
    ||||||||||||||||| | ||||||| || |||||||||||||| ||||||||    
1793806 cacaaccccacaaaacctgcttgtgaggtgaggattgcccccactaataaacat 1793753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #117
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 460 - 517
Target Start/End: Original strand, 6001455 - 6001512
Alignment:
460 ttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaacat 517  Q
    |||||| ||||| |||||| |||||| |||| || |||||||||||||||||||||||    
6001455 ttaacataaccctacaaaatcggtttctgaggtgaggattgcccccacttataaacat 6001512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #118
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 439 - 516
Target Start/End: Complemental strand, 6634940 - 6634863
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| || | ||||| | |||||||||||||||||||  | || |||| || ||||||||||||||||||||||    
6634940 tcttagaaatcatggttgggcctaacacaaccccacaaaactagcttatgaggtgaggattgcccccacttataaaca 6634863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #119
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 439 - 516
Target Start/End: Complemental strand, 21861379 - 21861302
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| | || ||||| | |||||||| ||||||||||||| |||| || || ||||||||| ||||||||||||    
21861379 tcttagaaatggtggttgggcctaacacaatcccacaaaaccggcttgtaaggtgaggattgccctcacttataaaca 21861302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #120
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 661 - 722
Target Start/End: Complemental strand, 32474585 - 32474524
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattg 722  Q
    |||||||| | ||||||||||||||| ||| |||||||||| || ||||||| |||||||||    
32474585 tcttagaaattgtggttgggcctaacgcaaacccacaaaaccggcttgtgaggtgaggattg 32474524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #121
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 631 - 739
Target Start/End: Original strand, 40898890 - 40898998
Alignment:
631 ccaatggatcttgaag-agactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctca 729  Q
    |||| ||||||||||| |||||| ||||  ||||||||| ||||| ||| ||||||||||| |||| |||||  | ||||||| ||| ||||| ||| ||    
40898890 ccaacggatcttgaaggagactcggatacaatcttagaattcgtgattgagcctaacacaatcccataaaaccagcttgtgaggtgatgattg-ccccca 40898988  T
730 cttataaaca 739  Q
    ||||||||||    
40898989 cttataaaca 40898998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #122
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 461 - 514
Target Start/End: Original strand, 40991765 - 40991818
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaa 514  Q
    |||||||||| ||||||||| | |||||||||| ||||| ||||||||||||||    
40991765 taacacaacctcacaaaaccagattgtgagatgaggattacccccacttataaa 40991818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #123
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 439 - 516
Target Start/End: Original strand, 43688159 - 43688235
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| |||| ||||| | |||||||||||||| ||||||| ||| ||| |  ||||||||||||||||||||||    
43688159 tcttagaaatcgtggttgggcctaacacaaccccac-aaaccggcttgagaggtaaggattgcccccacttataaaca 43688235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #124
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 437 - 513
Target Start/End: Complemental strand, 1000636 - 1000560
Alignment:
437 agtcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataa 513  Q
    |||||||||| |||| ||||| |  || |||||||||||||||||  |||| || || |||||||||||||||||||    
1000636 agtcttagaaatcgtggttgggccaaagacaaccccacaaaaccgtcttgtaaggtgaggattgcccccacttataa 1000560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #125
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 661 - 701
Target Start/End: Original strand, 7786253 - 7786293
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaac 701  Q
    |||||||| || |||||||||||||||||||||||||||||    
7786253 tcttagaaatcatggttgggcctaacacaaccccacaaaac 7786293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #126
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 461 - 517
Target Start/End: Complemental strand, 10903148 - 10903092
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaacat 517  Q
    ||||||||| |||||||||||| ||||||| || ||||| |||| ||||||||||||    
10903148 taacacaactccacaaaaccggcttgtgaggtgaggattacccctacttataaacat 10903092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #127
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 462 - 514
Target Start/End: Original strand, 11211701 - 11211752
Alignment:
462 aacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaa 514  Q
    ||||||||||||||||||||| ||||||| || |||||| |||||||||||||    
11211701 aacacaaccccacaaaaccggcttgtgaggtgaggattg-ccccacttataaa 11211752  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #128
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 552 - 616
Target Start/End: Original strand, 35308271 - 35308335
Alignment:
552 tcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacc 616  Q
    |||| |||||||||||||| ||||||||||||| ||||| ||||| || || ||||||| |||||    
35308271 tcacgaccagcactattgggcttggttcgtggacataaacggtggatgacctgatagcgaaaacc 35308335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #129
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 661 - 701
Target Start/End: Original strand, 48420741 - 48420781
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaac 701  Q
    |||||||| ||||||||||||||| ||||||||||||||||    
48420741 tcttagaattcgtggttgggcctagcacaaccccacaaaac 48420781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #130
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 661 - 736
Target Start/End: Complemental strand, 1000634 - 1000560
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataa 736  Q
    |||||||| ||||||||||||| || ||||||||||||||| |  |||| || ||||||||| ||| |||||||||    
1000634 tcttagaaatcgtggttgggccaaagacaaccccacaaaaccgtcttgtaaggtgaggattg-cccccacttataa 1000560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #131
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 461 - 516
Target Start/End: Original strand, 2544236 - 2544291
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    ||||||||||||||||||| || |||| || ||  |||||||||||||||||||||    
2544236 taacacaaccccacaaaactggcttgtaaggtgaagattgcccccacttataaaca 2544291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #132
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 461 - 516
Target Start/End: Original strand, 23796205 - 23796260
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||||||||||||| |  |||||||| ||  |||||||||||||||||||||    
23796205 taacacaaccccacaaaatcaatttgtgaggtgatgattgcccccacttataaaca 23796260  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #133
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 672 - 739
Target Start/End: Original strand, 32278895 - 32278961
Alignment:
672 gtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    ||||||| ||||||||||||| |||||||| || || |||| ||| ||||||||| ||||||||||||    
32278895 gtggttgagcctaacacaacctcacaaaaccggcttatgaggtgacgattgtccc-cacttataaaca 32278961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #134
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 461 - 516
Target Start/End: Complemental strand, 40746328 - 40746273
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||||||||||||| ||| || |||| || ||||||||| ||||||||||||    
40746328 taacacaaccccacaaaatcggcttatgaggtgaggattgccctcacttataaaca 40746273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #135
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 672 - 739
Target Start/End: Complemental strand, 47849645 - 47849579
Alignment:
672 gtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    ||||||| ||||||||||| |||||||||| || ||||||| ||||||||| |||  |||||||||||    
47849645 gtggttgagcctaacacaagcccacaaaaccgggttgtgaggtgaggattg-ccccaacttataaaca 47849579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #136
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 557 - 627
Target Start/End: Original strand, 1936243 - 1936312
Alignment:
557 accagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggt 627  Q
    |||| ||||||||| | |||||||| || ||||||||| ||||||  |||||||||||||||||| |||||    
1936243 accaacactattgggcatggttcgttgacataaatggtaggtggct-gatagcggaaacctgataacaggt 1936312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #137
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 439 - 517
Target Start/End: Complemental strand, 4886414 - 4886336
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaacat 517  Q
    |||||||| |||| ||||| | |||||||||| | | ||||||| ||||||| || |||||||||||| | ||||||||    
4886414 tcttagaaatcgtggttgggcctaacacaacctcgccaaaccggcttgtgaggtgaggattgcccccattaataaacat 4886336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #138
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 439 - 509
Target Start/End: Complemental strand, 32474585 - 32474515
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccactt 509  Q
    |||||||| | || ||||| | |||| ||| ||||||||||||| ||||||| || |||||||||||||||    
32474585 tcttagaaattgtggttgggcctaacgcaaacccacaaaaccggcttgtgaggtgaggattgcccccactt 32474515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #139
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 661 - 739
Target Start/End: Original strand, 43075309 - 43075386
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||| ||||||||| ||  ||||||||||||||||||    ||||||| ||||||||| ||| ||||||||||||    
43075309 tcttagaaatcgtggttgagctcaacacaaccccacaaaaccaacttgtgaggtgaggattg-cccccacttataaaca 43075386  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #140
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 654 - 712
Target Start/End: Original strand, 47955339 - 47955397
Alignment:
654 gatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgag 712  Q
    |||| |||||||||| || | |||||||||||  |||||||||||||| ||||||||||    
47955339 gataccatcttagaattcattgttgggcctaatgcaaccccacaaaaccggtttgtgag 47955397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #141
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 654 - 712
Target Start/End: Original strand, 47955420 - 47955478
Alignment:
654 gatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgag 712  Q
    |||| |||||||||| || | |||||||||||  |||||||||||||| ||||||||||    
47955420 gataccatcttagaattcattgttgggcctaatgcaaccccacaaaaccggtttgtgag 47955478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #142
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 654 - 712
Target Start/End: Original strand, 47955501 - 47955559
Alignment:
654 gatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgag 712  Q
    |||| |||||||||| || | |||||||||||  |||||||||||||| ||||||||||    
47955501 gataccatcttagaattcattgttgggcctaatgcaaccccacaaaaccggtttgtgag 47955559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #143
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 654 - 712
Target Start/End: Original strand, 47955582 - 47955640
Alignment:
654 gatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgag 712  Q
    |||| |||||||||| || | |||||||||||  |||||||||||||| ||||||||||    
47955582 gataccatcttagaattcattgttgggcctaatgcaaccccacaaaaccggtttgtgag 47955640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #144
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 654 - 712
Target Start/End: Original strand, 47955663 - 47955721
Alignment:
654 gatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgag 712  Q
    |||| |||||||||| || | |||||||||||  |||||||||||||| ||||||||||    
47955663 gataccatcttagaattcattgttgggcctaatgcaaccccacaaaaccggtttgtgag 47955721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #145
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 654 - 712
Target Start/End: Original strand, 47955744 - 47955802
Alignment:
654 gatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgag 712  Q
    |||| |||||||||| || | |||||||||||  |||||||||||||| ||||||||||    
47955744 gataccatcttagaattcattgttgggcctaatgcaaccccacaaaaccggtttgtgag 47955802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #146
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 581 - 614
Target Start/End: Complemental strand, 1751767 - 1751734
Alignment:
581 tggaaataaatggtgggtggcccgatagcggaaa 614  Q
    ||||||||||||||||||| ||||||||||||||    
1751767 tggaaataaatggtgggtgacccgatagcggaaa 1751734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #147
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 557 - 622
Target Start/End: Original strand, 14540871 - 14540936
Alignment:
557 accagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatag 622  Q
    |||||||||||||| ||||||| ||||| |||||| | ||| | |||||||| | |||||||||||    
14540871 accagcactattgggcttggtttgtggacataaatagcgggcgacccgatagtgaaaacctgatag 14540936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #148
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 661 - 722
Target Start/End: Complemental strand, 21822128 - 21822067
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattg 722  Q
    |||||||| | ||||||||| ||||||||| |||||||||   | |||||||||||||||||    
21822128 tcttagaaattgtggttgggtctaacacaaacccacaaaatctgcttgtgagatgaggattg 21822067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #149
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 670 - 739
Target Start/End: Original strand, 31485433 - 31485500
Alignment:
670 tcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||||| |||||||||||| ||||||||  ||||||||  ||||||||| ||| ||||||||||||    
31485433 tcgtggttgg-cctaacacaacctcacaaaaccagtttgtgatgtgaggattg-cccccacttataaaca 31485500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #150
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 461 - 514
Target Start/End: Original strand, 31485680 - 31485733
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaa 514  Q
    |||||||||  ||||||||||| |||| || || ||||||||||||||||||||    
31485680 taacacaacttcacaaaaccggcttgtcaggtgaggattgcccccacttataaa 31485733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #151
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 463 - 516
Target Start/End: Complemental strand, 32292580 - 32292527
Alignment:
463 acacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    ||||||||||||||| |||| ||||||| || |||  |||||||||||||||||    
32292580 acacaaccccacaaatccggcttgtgaggtgaggaccgcccccacttataaaca 32292527  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #152
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 552 - 625
Target Start/End: Original strand, 35308366 - 35308439
Alignment:
552 tcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcag 625  Q
    ||||||||| || ||||||  |||||||||||| ||| | | |||||| |||||||||| |||||| |||||||    
35308366 tcacaaccaacattattgggtttggttcgtggacatagacgatgggtgacccgatagcgaaaacctaatagcag 35308439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #153
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 460 - 516
Target Start/End: Complemental strand, 46452697 - 46452640
Alignment:
460 ttaacacaaccccacaaaaccggtttgtgagatgtggattgc-ccccacttataaaca 516  Q
    |||||||||||||||||||||   ||||||| || ||||||| |||||||||||||||    
46452697 ttaacacaaccccacaaaaccaacttgtgaggtgaggattgccccccacttataaaca 46452640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #154
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 579 - 616
Target Start/End: Complemental strand, 47849723 - 47849686
Alignment:
579 cgtggaaataaatggtgggtggcccgatagcggaaacc 616  Q
    |||||| |||||||||||||||||||||| ||||||||    
47849723 cgtggatataaatggtgggtggcccgataacggaaacc 47849686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #155
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 461 - 514
Target Start/End: Original strand, 48661576 - 48661629
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaa 514  Q
    |||||||| | ||||||||||| ||||||| || ||||||||||||| ||||||    
48661576 taacacaatctcacaaaaccggcttgtgaggtgaggattgcccccacctataaa 48661629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0048 (Bit Score: 102; Significance: 3e-50; HSPs: 4)
Name: scaffold0048
Description:

Target: scaffold0048; HSP #1
Raw Score: 102; E-Value: 3e-50
Query Start/End: Original strand, 527 - 740
Target Start/End: Complemental strand, 82060 - 81849
Alignment:
527 gatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcagg 626  Q
    |||||||||| ||||| ||||| |||||| |||||||||||||| |||||||| |||| |||||||||| ||||| |||| | |||||||||||| ||||    
82060 gatgtgggactcttaacacaccccctcacgaccagcactattgggcttggttcatggacataaatggtgcgtggctcgat-gtggaaacctgataacagg 81962  T
627 tagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccc 726  Q
    ||| ||||||||||||| |||| ||| |||| |||||||||| |||||||||||||||||||||||||||||||| |  |||| || |||  ||||||||    
81961 tagtccaatggatcttggagaggctctgataccatcttagaaatcgtggttgggcctaacacaaccccacaaaaccgacttgtaaggtgaaaattgtccc 81862  T
727 tcacttataaacat 740  Q
     |||||||||||||    
81861 -cacttataaacat 81849  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0048; HSP #2
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 661 - 709
Target Start/End: Complemental strand, 82161 - 82113
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgt 709  Q
    |||||||| | |||||||||||||||||||||||||||||| |||||||    
82161 tcttagaaattgtggttgggcctaacacaaccccacaaaaccggtttgt 82113  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0048; HSP #3
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 433 - 512
Target Start/End: Complemental strand, 82167 - 82088
Alignment:
433 tctaagtcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttata 512  Q
    ||||| |||||||| | || ||||| | ||||||||||||||||||||||||||| |  || ||||| |||||| |||||    
82167 tctaactcttagaaattgtggttgggcctaacacaaccccacaaaaccggtttgtaatttgaggatttcccccatttata 82088  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0048; HSP #4
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 439 - 517
Target Start/End: Complemental strand, 81927 - 81849
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaacat 517  Q
    |||||||| |||| ||||| | |||||||||||||||||||||  |||| || ||   |||| ||||||||||||||||    
81927 tcttagaaatcgtggttgggcctaacacaaccccacaaaaccgacttgtaaggtgaaaattgtccccacttataaacat 81849  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0129 (Bit Score: 95; Significance: 5e-46; HSPs: 2)
Name: scaffold0129
Description:

Target: scaffold0129; HSP #1
Raw Score: 95; E-Value: 5e-46
Query Start/End: Original strand, 565 - 739
Target Start/End: Complemental strand, 14484 - 14311
Alignment:
565 tattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatctt 664  Q
    |||||| |||| |||||||| ||||||||| |||||||||||||||||||||||||| ||  | ||||||||||||||| |||| ||| |||| ||||||    
14484 tattgggcttgattcgtggacataaatggtaggtggcccgatagcggaaacctgataacatatggcccaatggatcttggagaggctctgataccatctt 14385  T
665 agaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    ||||  ||||||||||||||||||||||||||||||| || ||||||| ||| ||||||||| ||||||||||||    
14384 agaaaacgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgatgattgtccc-cacttataaaca 14311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0129; HSP #2
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 439 - 516
Target Start/End: Complemental strand, 14388 - 14311
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    ||||||||  ||| ||||| | |||||||||||||||||||||| ||||||| ||  ||||| |||||||||||||||    
14388 tcttagaaaacgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgatgattgtccccacttataaaca 14311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0092 (Bit Score: 90; Significance: 5e-43; HSPs: 3)
Name: scaffold0092
Description:

Target: scaffold0092; HSP #1
Raw Score: 90; E-Value: 5e-43
Query Start/End: Original strand, 515 - 739
Target Start/End: Complemental strand, 5886 - 5663
Alignment:
515 catcttatattcgatgtgggacgcttaatacaccacctcacaaccagcactatt-ggacttggttcgtggaaataaatggtgggtggcccgatagcggaa 613  Q
    |||||| ||| |||||||| ||  |||| ||||| |||||| ||||||| |||| || ||||||||||||  ||||| ||||||||   ||||| |||||    
5886 catcttctatccgatgtggaactgttaacacacc-cctcacgaccagcattatttgggcttggttcgtgggcataaacggtgggtgattcgataacggaa 5788  T
614 acctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgaga 713  Q
    |||||||||||||| ||||||||||| |||||||| ||| |||| |||||||||| ||||||||||| |||||||||||||||||||| || |||| |||    
5787 acctgatagcaggtggcccaatggattttgaagaggctctgataccatcttagaaatcgtggttgggtctaacacaaccccacaaaaccggcttgtaaga 5688  T
714 tgaggattgtccctcacttataaaca 739  Q
    ||||||||  ||| ||||||||||||    
5687 tgaggatt-acccccacttataaaca 5663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0092; HSP #2
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 439 - 516
Target Start/End: Complemental strand, 5740 - 5663
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| |||| |||||   |||||||||||||||||||||| |||| ||||| ||||| ||||||||||||||||    
5740 tcttagaaatcgtggttgggtctaacacaaccccacaaaaccggcttgtaagatgaggattacccccacttataaaca 5663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0092; HSP #3
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 439 - 517
Target Start/End: Complemental strand, 5975 - 5897
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaacat 517  Q
    |||||||| |||||||||||| ||||||||||  |||||| ||| |||  || || |||||| || |||||||||||||    
5975 tcttagaaatcgtagttggacctaacacaacctaacaaaatcggcttgaaaggtgaggattgtcctcacttataaacat 5897  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0400 (Bit Score: 84; Significance: 2e-39; HSPs: 1)
Name: scaffold0400
Description:

Target: scaffold0400; HSP #1
Raw Score: 84; E-Value: 2e-39
Query Start/End: Original strand, 588 - 739
Target Start/End: Complemental strand, 4003 - 3852
Alignment:
588 aaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaaca 687  Q
    ||||| |||||||||||||||||||||||||||||||||| ||||| ||||||||| ||||  || |||| ||| |||||| | ||||||| ||||||||    
4003 aaatgatgggtggcccgatagcggaaacctgatagcaggtggcccagtggatcttggagaggatctgataccatattagaaattgtggttgtgcctaaca 3904  T
688 caaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    ||||||||||||||||| ||||||| ||||||||| ||| ||||||| ||||    
3903 caaccccacaaaactggcttgtgaggtgaggattgccccccacttattaaca 3852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0365 (Bit Score: 84; Significance: 2e-39; HSPs: 1)
Name: scaffold0365
Description:

Target: scaffold0365; HSP #1
Raw Score: 84; E-Value: 2e-39
Query Start/End: Original strand, 588 - 739
Target Start/End: Complemental strand, 4647 - 4496
Alignment:
588 aaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaaca 687  Q
    ||||| |||||||||||||||||||||||||||||||||| ||||| ||||||||| ||||  || |||| ||| |||||| | ||||||| ||||||||    
4647 aaatgatgggtggcccgatagcggaaacctgatagcaggtggcccagtggatcttggagaggatctgataccatattagaaattgtggttgtgcctaaca 4548  T
688 caaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    ||||||||||||||||| ||||||| ||||||||| ||| ||||||| ||||    
4547 caaccccacaaaactggcttgtgaggtgaggattgccccccacttattaaca 4496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0047 (Bit Score: 70; Significance: 4e-31; HSPs: 1)
Name: scaffold0047
Description:

Target: scaffold0047; HSP #1
Raw Score: 70; E-Value: 4e-31
Query Start/End: Original strand, 458 - 722
Target Start/End: Complemental strand, 12947 - 12671
Alignment:
458 acttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaa-------------catcttatattcgatgtgggacgcttaata 544  Q
    |||||||||||||  | ||||||||||||| ||||| ||||||||||||||||||||             ||||   ||||||||||||| | ||||| |    
12947 acttaacacaacctgataaaaccggtttgtaagatgaggattgcccccacttataaattcattgtcaagccatcacctattcgatgtggggctcttaaca 12848  T
545 caccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttga 644  Q
    |||| ||||||  ||||||||||||  ||||||||||| | ||||||||||||||  ||||||||| || |||||||| |||| |||||||  ||||||     
12847 caccccctcacg-ccagcactattgagcttggttcgtgaacataaatggtgggtgttccgatagcgaaatcctgatagtaggtggcccaatttatcttgg 12749  T
645 agagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattg 722  Q
    |||||| |  ||| ||||||| || | ||||||||||||||||||||| |||||||  |  ||||||| |||||||||    
12748 agagacgctaataccatcttaaaaattgtggttgggcctaacacaaccacacaaaatcgacttgtgaggtgaggattg 12671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005 (Bit Score: 62; Significance: 2e-26; HSPs: 3)
Name: scaffold0005
Description:

Target: scaffold0005; HSP #1
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 586 - 739
Target Start/End: Complemental strand, 56619 - 56467
Alignment:
586 ataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaa 685  Q
    |||||||  ||||||||||||| || |||||||||| ||||| |||||| | ||  ||||||| ||| |||| ||| |||||| ||||||||||||||||    
56619 ataaatgacgggtggcccgataacgaaaacctgataacaggtggcccaaagaattgtgaagaggctctgataccatattagaaatcgtggttgggcctaa 56520  T
686 cacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||||||||||| || ||||||| ||| ||||| ||| || |||||||||    
56519 cacaaccccacaaaaccggcttgtgaggtgatgattg-cccacagttataaaca 56467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005; HSP #2
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 441 - 516
Target Start/End: Complemental strand, 56542 - 56467
Alignment:
441 ttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||| |||| ||||| | |||||||||||||||||||||| ||||||| ||  |||||||| || |||||||||    
56542 ttagaaatcgtggttgggcctaacacaaccccacaaaaccggcttgtgaggtgatgattgcccacagttataaaca 56467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005; HSP #3
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 661 - 722
Target Start/End: Original strand, 288656 - 288717
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattg 722  Q
    |||||||| || ||||||||||||||||||| |||||||||  | ||||||| |||||||||    
288656 tcttagaaatcatggttgggcctaacacaactccacaaaaccagcttgtgaggtgaggattg 288717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0366 (Bit Score: 60; Significance: 4e-25; HSPs: 2)
Name: scaffold0366
Description:

Target: scaffold0366; HSP #1
Raw Score: 60; E-Value: 4e-25
Query Start/End: Original strand, 522 - 652
Target Start/End: Complemental strand, 14629 - 14498
Alignment:
522 tattcgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatag-cggaaacctgat 620  Q
    ||||||||||  ||| ||||| ||||| | |||| |||| ||||||||| |||||||| |||| |||||| ||||||| |||||||| ||||||||||||    
14629 tattcgatgtatgactcttaacacaccccatcacgaccaacactattgggcttggttcatggacataaatagtgggtgacccgataggcggaaacctgat 14530  T
621 agcaggtagcccaatggatcttgaagagactc 652  Q
    ||||||| | ||||||||||||| ||||||||    
14529 agcaggtggtccaatggatcttggagagactc 14498  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0366; HSP #2
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 522 - 652
Target Start/End: Complemental strand, 10963 - 10832
Alignment:
522 tattcgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatag-cggaaacctgat 620  Q
    ||||||||||  ||| ||||| ||||| | |||| |||| ||||||||| |||||||| |||| |||||| ||||||| ||| |||| ||||||||||||    
10963 tattcgatgtatgactcttaacacaccccatcacgaccaacactattgggcttggttcatggacataaatagtgggtgacccaataggcggaaacctgat 10864  T
621 agcaggtagcccaatggatcttgaagagactc 652  Q
    ||||||| | ||||||||||||| ||||||||    
10863 agcaggtggtccaatggatcttggagagactc 10832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0045 (Bit Score: 60; Significance: 4e-25; HSPs: 2)
Name: scaffold0045
Description:

Target: scaffold0045; HSP #1
Raw Score: 60; E-Value: 4e-25
Query Start/End: Original strand, 576 - 739
Target Start/End: Original strand, 41120 - 41281
Alignment:
576 gttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtgg 675  Q
    ||||||||  |||||| ||||||||  |||||||| |||| ||||||||||| |||||||| |||||| |||| ||| |||| |||||||||| |||| |    
41120 gttcgtgggcataaatagtgggtggttcgatagcgcaaacttgatagcaggtggcccaatgaatcttggagaggctctgataccatcttagaaatcgtag 41219  T
676 ttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    ||| |||||| |||||||||||||| | | | ||||||| |||||||| || ||||||||||||    
41220 ttgagcctaatacaaccccacaaaa-tcggtagtgagattaggattgt-ccacacttataaaca 41281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0045; HSP #2
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 670 - 738
Target Start/End: Original strand, 40978 - 41045
Alignment:
670 tcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaac 738  Q
    ||||||||||| ||||||||| |||| |||||| ||||||||| | | |||||||||| ||||||||||    
40978 tcgtggttgggtctaacacaatcccataaaactagtttgtgaggttatgattgtccct-acttataaac 41045  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0459 (Bit Score: 56; Significance: 9e-23; HSPs: 1)
Name: scaffold0459
Description:

Target: scaffold0459; HSP #1
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 522 - 652
Target Start/End: Complemental strand, 13322 - 13191
Alignment:
522 tattcgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatag-cggaaacctgat 620  Q
    ||||||||||  ||| ||||| ||||| | |||| |||| ||||||||| |||||||| |||| |||||| ||||||| ||| |||| ||||||||||||    
13322 tattcgatgtatgactcttaacacaccccatcacgaccaacactattgggcttggttcatggacataaatagtgggtgacccaataggcggaaacctgat 13223  T
621 agcaggtagcccaatggatcttgaagagactc 652  Q
    ||||||| | ||||||||||||| ||||||||    
13222 agcaggtggtccaatggatcttggagagactc 13191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0729 (Bit Score: 55; Significance: 4e-22; HSPs: 1)
Name: scaffold0729
Description:

Target: scaffold0729; HSP #1
Raw Score: 55; E-Value: 4e-22
Query Start/End: Original strand, 526 - 624
Target Start/End: Complemental strand, 2714 - 2616
Alignment:
526 cgatgtgggacgcttaatacaccacctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagca 624  Q
    ||||||||||| ||||| ||||| |||||| | |||||||||| |  ||||||||| || |||||||| ||||||||||||||||||||||||||||||    
2714 cgatgtgggactcttaacacaccccctcacgatcagcactattaggtttggttcgtagacataaatggggggtggcccgatagcggaaacctgatagca 2616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0083 (Bit Score: 51; Significance: 9e-20; HSPs: 3)
Name: scaffold0083
Description:

Target: scaffold0083; HSP #1
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 550 - 664
Target Start/End: Complemental strand, 51469 - 51355
Alignment:
550 cctcacaaccagcactattggacttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagaga 649  Q
    ||||||||||| ||||||||| ||||||||||| | ||||||| | |||||||||||||  ||||||||||||||||   |||||||||||||| |||      
51469 cctcacaaccaacactattgggcttggttcgtgaacataaatgataggtggcccgatagtagaaacctgatagcaggagacccaatggatcttggagaag 51370  T
650 ctcagatatcatctt 664  Q
    ||| |||| ||||||    
51369 ctctgataccatctt 51355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0083; HSP #2
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 629 - 739
Target Start/End: Complemental strand, 51353 - 51244
Alignment:
629 gcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctc 728  Q
    |||||||| || ||| |||| | | |||| |||||||||| | ||| ||| || |||||||||||||||||||||  ||||||| ||||||||| ||| |    
51353 gcccaatgaattttggagaggcactgataccatcttagaaattgtgattgagcataacacaaccccacaaaactgacttgtgaggtgaggattg-ccccc 51255  T
729 acttataaaca 739  Q
    |||||||||||    
51254 acttataaaca 51244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0083; HSP #3
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 461 - 516
Target Start/End: Complemental strand, 51299 - 51244
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    ||||||||||||||||||| |  ||||||| || ||||||||||||||||||||||    
51299 taacacaaccccacaaaactgacttgtgaggtgaggattgcccccacttataaaca 51244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0481 (Bit Score: 46; Significance: 8e-17; HSPs: 2)
Name: scaffold0481
Description:

Target: scaffold0481; HSP #1
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 594 - 739
Target Start/End: Original strand, 3403 - 3547
Alignment:
594 tgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaagagactcagatatcatcttagaactcgtggttgggcctaacacaaccc 693  Q
    |||||| | ||||| ||||||||| ||| |||||  ||||| | ||  |||| || ||| |||| ||| |||||| ||||| ||||| ||||||||||||    
3403 tgggtgactcgataacggaaacctaataacaggtgacccaaagaattatgaaaaggctctgataccatattagaaatcgtgattgggtctaacacaaccc 3502  T
694 cacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||||||| || ||||||| ||| ||||||||| ||||||||||||    
3503 cacaaaaccggcttgtgaggtgaagattgtccc-cacttataaaca 3547  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0481; HSP #2
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 461 - 516
Target Start/End: Original strand, 3492 - 3547
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||||||||||||||||| ||||||| ||  ||||| |||||||||||||||    
3492 taacacaaccccacaaaaccggcttgtgaggtgaagattgtccccacttataaaca 3547  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0003 (Bit Score: 45; Significance: 3e-16; HSPs: 4)
Name: scaffold0003
Description:

Target: scaffold0003; HSP #1
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 580 - 723
Target Start/End: Original strand, 102295 - 102438
Alignment:
580 gtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaag-agactcagatatcatcttagaactcgtggttg 678  Q
    ||||| |||||||||||||| |||||||| |||||||||||||||||| | ||||| ||| ||| || |||||| |||||||||||| || | ||| |||    
102295 gtggatataaatggtgggtgacccgatagtggaaacctgatagcaggt-gtccaatagattttggagaagactctgatatcatcttaaaaattgtgattg 102393  T
679 ggcctaacacaaccccacaaaactggtttgtgagatgaggattgt 723  Q
    || |  |||||| ||||||||||   ||||| || ||||||||||    
102394 ggtcgtacacaagcccacaaaaccaatttgttaggtgaggattgt 102438  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0003; HSP #2
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 580 - 636
Target Start/End: Original strand, 87727 - 87783
Alignment:
580 gtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatg 636  Q
    ||||| |||||||||||||| |||||||| |||||||||||||||||| ||||||||    
87727 gtggatataaatggtgggtgacccgatagtggaaacctgatagcaggtggcccaatg 87783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0003; HSP #3
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 439 - 516
Target Start/End: Original strand, 347570 - 347647
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||| |||||||||| | ||| |||||||||||||||||| ||||||| |   || |||||||| |||||||||    
347570 tcttagaattcgtagttgggcctaatacaaccccacaaaaccggcttgtgaggtaaagactgcccccaattataaaca 347647  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0003; HSP #4
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 661 - 712
Target Start/End: Original strand, 347570 - 347621
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgag 712  Q
    |||||||| |||| ||||||||||| ||||||||||||||| || |||||||    
347570 tcttagaattcgtagttgggcctaatacaaccccacaaaaccggcttgtgag 347621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0334 (Bit Score: 44; Significance: 0.000000000000001; HSPs: 2)
Name: scaffold0334
Description:

Target: scaffold0334; HSP #1
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 461 - 516
Target Start/End: Original strand, 4450 - 4505
Alignment:
461 taacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||||||||||||||||| ||||||| || ||||||||||||||||||||||    
4450 taacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaaca 4505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0334; HSP #2
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 664 - 739
Target Start/End: Original strand, 4431 - 4505
Alignment:
664 tagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    ||||| || |||||| |||||||||||||||||||||| || ||||||| ||||||||| ||| ||||||||||||    
4431 tagaaatcatggttgagcctaacacaaccccacaaaaccggcttgtgaggtgaggattg-cccccacttataaaca 4505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0766 (Bit Score: 43; Significance: 0.000000000000005; HSPs: 2)
Name: scaffold0766
Description:

Target: scaffold0766; HSP #1
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 665 - 739
Target Start/End: Complemental strand, 6355 - 6282
Alignment:
665 agaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctcacttataaaca 739  Q
    |||| |||||||||||||||||||||||||||||||  || ||||||| ||||||||| ||| ||||||||||||    
6355 agaaatcgtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgaggattg-cccccacttataaaca 6282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0766; HSP #2
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 443 - 516
Target Start/End: Complemental strand, 6355 - 6282
Alignment:
443 agaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||| |||| ||||| | |||||||||||||||||| ||| ||||||| || ||||||||||||||||||||||    
6355 agaaatcgtggttgggcctaacacaaccccacaaaatcggcttgtgaggtgaggattgcccccacttataaaca 6282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0181 (Bit Score: 41; Significance: 0.00000000000008; HSPs: 2)
Name: scaffold0181
Description:

Target: scaffold0181; HSP #1
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 661 - 721
Target Start/End: Complemental strand, 21024 - 20964
Alignment:
661 tcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggatt 721  Q
    |||||||| |||||||||||| ||||||||||||||||||| || ||||||| ||||||||    
21024 tcttagaaatcgtggttgggcttaacacaaccccacaaaaccggcttgtgaggtgaggatt 20964  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0181; HSP #2
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 439 - 514
Target Start/End: Complemental strand, 21024 - 20949
Alignment:
439 tcttagaactcgtagttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaa 514  Q
    |||||||| |||| ||||| |||||||||||||||||||||||| ||||||| || ||||| ||  ||||||||||    
21024 tcttagaaatcgtggttgggcttaacacaaccccacaaaaccggcttgtgaggtgaggattaccttcacttataaa 20949  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0050 (Bit Score: 41; Significance: 0.00000000000008; HSPs: 1)
Name: scaffold0050
Description:

Target: scaffold0050; HSP #1
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 464 - 516
Target Start/End: Original strand, 69557 - 69609
Alignment:
464 cacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||||| |||||||||||||||| || ||||||||||||||||||||||    
69557 cacaaccccataaaaccggtttgtgaggtgaggattgcccccacttataaaca 69609  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0542 (Bit Score: 39; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0542
Description:

Target: scaffold0542; HSP #1
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 573 - 647
Target Start/End: Complemental strand, 5802 - 5728
Alignment:
573 ttggttcgtggaaataaatggtgggtggcccgatagcggaaacctgatagcaggtagcccaatggatcttgaaga 647  Q
    |||||||||||| ||||||| | |||||| |||||||| ||| ||||||||||||  |||||| |||||||||||    
5802 ttggttcgtggacataaatgataggtggctcgatagcgaaaatctgatagcaggtgacccaatagatcttgaaga 5728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0041 (Bit Score: 36; Significance: 0.00000000008; HSPs: 2)
Name: scaffold0041
Description:

Target: scaffold0041; HSP #1
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 453 - 516
Target Start/End: Complemental strand, 67556 - 67493
Alignment:
453 gttggacttaacacaaccccacaaaaccggtttgtgagatgtggattgcccccacttataaaca 516  Q
    |||||||  |||||||| |||||||| |||||||| || || ||||||||||||||||||||||    
67556 gttggaccaaacacaactccacaaaatcggtttgtaaggtgaggattgcccccacttataaaca 67493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0041; HSP #2
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 631 - 739
Target Start/End: Complemental strand, 67394 - 67286
Alignment:
631 ccaatggatcttgaag-agactcagatatcatcttagaactcgtggttgggcctaacacaaccccacaaaactggtttgtgagatgaggattgtccctca 729  Q
    |||| ||||||||||| |||||| ||||  ||||||||| ||||| ||| ||||||||||| |||| |||||  | ||||||| ||| ||||| ||| ||    
67394 ccaacggatcttgaaggagactcggatacaatcttagaattcgtgattgagcctaacacaatcccataaaaccagcttgtgaggtgatgattg-ccccca 67296  T
730 cttataaaca 739  Q
    ||||||||||    
67295 cttataaaca 67286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University