View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11446_high_28 (Length: 378)

Name: NF11446_high_28
Description: NF11446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11446_high_28
NF11446_high_28
[»] chr2 (1 HSPs)
chr2 (286-368)||(27652254-27652337)


Alignment Details
Target: chr2 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 286 - 368
Target Start/End: Original strand, 27652254 - 27652337
Alignment:
286 taacgaaagaaacatccaaccagtagcgagnnnnnnnn-aatgtaaaaacagctaacccttcccaattttctattagacctatg 368  Q
    ||||||||||||||||||||||||||||||         ||||||||||||||||||| |||||||||||||||||||||||||    
27652254 taacgaaagaaacatccaaccagtagcgagtttttttttaatgtaaaaacagctaaccattcccaattttctattagacctatg 27652337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University