View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11446_high_35 (Length: 345)

Name: NF11446_high_35
Description: NF11446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11446_high_35
NF11446_high_35
[»] chr7 (2 HSPs)
chr7 (153-338)||(25420481-25420663)
chr7 (18-105)||(25420711-25420798)
[»] chr6 (1 HSPs)
chr6 (173-205)||(10158008-10158040)
[»] chr4 (1 HSPs)
chr4 (165-201)||(22596987-22597022)


Alignment Details
Target: chr7 (Bit Score: 128; Significance: 4e-66; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 128; E-Value: 4e-66
Query Start/End: Original strand, 153 - 338
Target Start/End: Complemental strand, 25420663 - 25420481
Alignment:
153 cgaatttaatccgagaaaattgacataattcaacgtaatcacatgtgtcggtaatcacatgtgtcagtatcatgtcggacacgtctttgatccaaagtgt 252  Q
    ||||| ||||||||||||||||||||||||||||||||||| ||||||| |||    |||||   |||||||||||||||||||||| |||| |||||||    
25420663 cgaatataatccgagaaaattgacataattcaacgtaatcagatgtgtcagtat---catgtcggagtatcatgtcggacacgtcttcgatcaaaagtgt 25420567  T
253 cggtgcttcaaagattacaaccaatagtttaagatacacaccgatccgcgaagagatttttggtaatcactattctgtctctgctc 338  Q
     ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
25420566 tggtgcttcaaagattacaaccaatagtttaagatacacaccgatccgcgaagagatttttggtaatcactattctgtttctgctc 25420481  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 18 - 105
Target Start/End: Complemental strand, 25420798 - 25420711
Alignment:
18 attataactacaattcaaatccggtctcataaaattgacataaacataaaatactcaatgaaaaagaactacattgcaacctatgaag 105  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
25420798 attataactacaattcaaatccggtctcataaaattgacataaacatgaaatactcaatgaaaaagaactacattgcaacctatgaag 25420711  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 173 - 205
Target Start/End: Original strand, 10158008 - 10158040
Alignment:
173 tgacataattcaacgtaatcacatgtgtcggta 205  Q
    ||||||||||||| |||||||||||||||||||    
10158008 tgacataattcaatgtaatcacatgtgtcggta 10158040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 165 - 201
Target Start/End: Complemental strand, 22597022 - 22596987
Alignment:
165 gagaaaattgacataattcaacgtaatcacatgtgtc 201  Q
    |||||||||| ||||||||||||||||||||||||||    
22597022 gagaaaattg-cataattcaacgtaatcacatgtgtc 22596987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University