View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11446_high_43 (Length: 309)
Name: NF11446_high_43
Description: NF11446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11446_high_43 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 107 - 291
Target Start/End: Complemental strand, 18767844 - 18767660
Alignment:
| Q |
107 |
tttcttgcatagcttatgagtgtatacaccttctgacaaagaggaaaagaggaaaaaagttcagcattcgatggtgtgaactcttcttccaaatattgaa |
206 |
Q |
| |
|
||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18767844 |
tttcttgtatagcttatgagtgtatacaccttgtgacaaagaggaaaagaggaaaaaagttcagcattcgatggtgtgaactcttcttccaaatattgaa |
18767745 |
T |
|
| Q |
207 |
ttatcgaggtcatccacctctttgtgtctacttcgatggcgtcaaccataatggcttctgtactgggcacatgtagggtcttttg |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18767744 |
ttatcgaggtcatccacctctttgtgtctacttcgatggcgtcaaccataatggcttctgtactgggcacatgtagggtcttttg |
18767660 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University