View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11446_high_43 (Length: 309)

Name: NF11446_high_43
Description: NF11446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11446_high_43
NF11446_high_43
[»] chr4 (1 HSPs)
chr4 (107-291)||(18767660-18767844)


Alignment Details
Target: chr4 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 107 - 291
Target Start/End: Complemental strand, 18767844 - 18767660
Alignment:
107 tttcttgcatagcttatgagtgtatacaccttctgacaaagaggaaaagaggaaaaaagttcagcattcgatggtgtgaactcttcttccaaatattgaa 206  Q
    ||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18767844 tttcttgtatagcttatgagtgtatacaccttgtgacaaagaggaaaagaggaaaaaagttcagcattcgatggtgtgaactcttcttccaaatattgaa 18767745  T
207 ttatcgaggtcatccacctctttgtgtctacttcgatggcgtcaaccataatggcttctgtactgggcacatgtagggtcttttg 291  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18767744 ttatcgaggtcatccacctctttgtgtctacttcgatggcgtcaaccataatggcttctgtactgggcacatgtagggtcttttg 18767660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University