View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11446_high_44 (Length: 308)
Name: NF11446_high_44
Description: NF11446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11446_high_44 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 1 - 301
Target Start/End: Original strand, 52471888 - 52472188
Alignment:
| Q |
1 |
aaacaacgttgacagccaaggatctgtgttagaaatgaaggttcaggatatggtccaagtgttggattgaggcccttggaagcccaacattgggagagaa |
100 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52471888 |
aaacaatgttgaaagccaaggatctgtgttagaaatgaaggagaacacaatggtccaagtgttggattgaggcccttggaagcccaacattgggagagaa |
52471987 |
T |
 |
| Q |
101 |
tataggctgagtgtggtggtacagtgagacgtgttttgtgatctcttttaacaccgtatagtaactgtcatgtctgcttgctgctgtttagacagaaact |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52471988 |
tataggctgagtgtggtggtacagtgagacgtgttttgtgatctcttttaacaccgtatagtaactgtcatgtctgcttgctgctgtttagacagaaact |
52472087 |
T |
 |
| Q |
201 |
cacccttcttttgttagccaatttaaaaccccatccttcttagtaacaccattcagcaaggtatagaaggaggcagtctcacccgtcgattgttgcctat |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
52472088 |
cacccttcttttgttagccaatttaaaaccccatccttcttagtaacaccattcagcaaggtatagaaggaggcagtctcatccgtcgattgttgcctat |
52472187 |
T |
 |
| Q |
301 |
g |
301 |
Q |
| |
|
| |
|
|
| T |
52472188 |
g |
52472188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University