View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11446_high_52 (Length: 268)
Name: NF11446_high_52
Description: NF11446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11446_high_52 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 18 - 254
Target Start/End: Complemental strand, 54843991 - 54843754
Alignment:
| Q |
18 |
aatctaagcaatgtgtattatttgaatctttttagtggtcgttaaagcaagcagcgggccaagatatgtagttggctgtcgtagtaaggtggacaaagag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54843991 |
aatctaagcaatgtgtattatttgaatctttttagtggtcgttaaagcaagcagcgggccaagatatgtagttggctgtcgtagtaaggtggacaaagag |
54843892 |
T |
|
| Q |
118 |
aagctgactgcaggaactcgagttgtgctggacatgactactctgaccattatgcgaattcttccccgtgaagtatgccctatcatctaatcttggaccc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54843891 |
aagctgactgcaggaactcgagttgtgctggacatgactactctgaccattatgcgaattcttccccgtgaagtatgccctatcatctaatcttggaccc |
54843792 |
T |
|
| Q |
218 |
-nnnnnnnnngtagatgataattgtttttacattcatt |
254 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
54843791 |
ttttttttttgtagatgataattgtttttacattcatt |
54843754 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University