View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11446_high_61 (Length: 242)
Name: NF11446_high_61
Description: NF11446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11446_high_61 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 1 - 103
Target Start/End: Complemental strand, 31848987 - 31848883
Alignment:
| Q |
1 |
ttaataaactgctgaaggagaaggtgctatgggatgatcctatgaaacatttagtaaaggttatgcaatgtaa--ctcttactgctggacacttatcatg |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||| |
|
|
| T |
31848987 |
ttaataaactgctgaaggagaaggtgctatgggatgatcctatgaaacatttagtaaaggttatgcaatgcaactctcttactgctggacacttatcatg |
31848888 |
T |
 |
| Q |
99 |
attcg |
103 |
Q |
| |
|
||||| |
|
|
| T |
31848887 |
attcg |
31848883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 159 - 225
Target Start/End: Complemental strand, 31848078 - 31848011
Alignment:
| Q |
159 |
taatggataacc-ttcaactaggtgatcagtggcaaacaattactatgcaactccaaataccgaaata |
225 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31848078 |
taatggataacccttcaactaggtgatcagtggcaaacaattactatgcaactccaaataccgaaata |
31848011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University