View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11446_high_70 (Length: 214)
Name: NF11446_high_70
Description: NF11446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11446_high_70 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 18 - 197
Target Start/End: Original strand, 31780725 - 31780902
Alignment:
| Q |
18 |
caaagggttaataaacttgtgtgccaagtttcgtcaggtttacggaagtatgattctagcacaaaagaaaggagctgaagaaaaagtagtgtcaaacatt |
117 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31780725 |
caaaggcttaataaacttgtgtgccaagtttcgtcaggtttacggaagtatgattctagcacaaaagaaaggagctgaagaaaaagtagtgtcaaacatt |
31780824 |
T |
|
| Q |
118 |
gacatcccacaaaagaaatggcccgagggtgtatggtagcagcagaaagagctgcaactgacagcatcaaacaatgtatc |
197 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31780825 |
tacatcccacaaaagaaatggcctgagg--gtatggtagcagcagaaagagctgcaactgacagcatcaaacaatgtatc |
31780902 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 18 - 87
Target Start/End: Original strand, 2243977 - 2244046
Alignment:
| Q |
18 |
caaagggttaataaacttgtgtgccaagtttcgtcaggtttacggaagtatgattctagcacaaaagaaa |
87 |
Q |
| |
|
|||||| |||||||||||| | ||||||||| |||||| |||||| |||||||| ||||||||||||||| |
|
|
| T |
2243977 |
caaaggcttaataaacttgcgcgccaagttttgtcaggcttacgggagtatgatcctagcacaaaagaaa |
2244046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University