View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11446_low_31 (Length: 378)
Name: NF11446_low_31
Description: NF11446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11446_low_31 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 286 - 368
Target Start/End: Original strand, 27652254 - 27652337
Alignment:
| Q |
286 |
taacgaaagaaacatccaaccagtagcgagnnnnnnnn-aatgtaaaaacagctaacccttcccaattttctattagacctatg |
368 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
27652254 |
taacgaaagaaacatccaaccagtagcgagtttttttttaatgtaaaaacagctaaccattcccaattttctattagacctatg |
27652337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University