View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11446_low_51 (Length: 301)
Name: NF11446_low_51
Description: NF11446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11446_low_51 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 17 - 179
Target Start/End: Complemental strand, 161733 - 161574
Alignment:
| Q |
17 |
cagattcatgaatgaggaggcttctctgttgataattgttgcattaatggttatctctcaacatatgtaatgatttattactccttctttcttcttctga |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
161733 |
cagattcatgaatgaggaggcttctctgttgataattgttgcattaatggttatctctcaacatatgtaatgatttattactccttctttc---ttctga |
161637 |
T |
 |
| Q |
117 |
agtacatgagaaactagcattgatttactctactgatggtatgggttttatagacaaactatc |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
161636 |
agtacatgagaaactagcattgatttactctattgatggtatgggttttatagacaaactatc |
161574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 175 - 277
Target Start/End: Complemental strand, 161549 - 161447
Alignment:
| Q |
175 |
ctatctaatgtgttgtgtggaggttggaactttgcttcatgccattcgagattgtattcatgctaatttgttgtttttatattcatgttgtctttttggg |
274 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
161549 |
ctatctaatgtgttgtgtggaggttagaactttgcttcatgccattcgagactgtattcatgctaatttgttgtttttatattgatgttgtctttttggg |
161450 |
T |
 |
| Q |
275 |
ttt |
277 |
Q |
| |
|
||| |
|
|
| T |
161449 |
ttt |
161447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University