View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11446_low_57 (Length: 265)
Name: NF11446_low_57
Description: NF11446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11446_low_57 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 1 - 247
Target Start/End: Original strand, 32224214 - 32224460
Alignment:
| Q |
1 |
agagaaagtagatagatagcaatgatgatggatgagggagaaggtaagaagaaagttgtggttcagaaaaccgaggcgtgtggtttcatggcaggtgttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32224214 |
agagaaagtagatagatagcaatgatgatggatgagggagaaggtaagaagaaagttgtggttcagaaaaccgaggcgtgtggtttcatggcaggtgttg |
32224313 |
T |
 |
| Q |
101 |
aagatgagctagggtttgtcaacgtgaaaggagacaacaacaacgggtcgggtcaacggatccatcatgatcatggttttgttgctgctgcatttggaac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32224314 |
aagatgagctagggtttgtcaacgtgaaaggagacaacaacaacgggtcgggtcaacggatccatcatgatcatggttttgttgctgctgcatttggaac |
32224413 |
T |
 |
| Q |
201 |
tgttcataggaagaaaaggatggctaggcaaagaagatcttcatctt |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32224414 |
tgttcataggaagaaaaggatggctaggcaaagaagatcttcatctt |
32224460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University