View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11446_low_62 (Length: 249)
Name: NF11446_low_62
Description: NF11446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11446_low_62 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 99; Significance: 6e-49; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 130 - 244
Target Start/End: Original strand, 49996430 - 49996543
Alignment:
| Q |
130 |
cacattgttaaactatgtacgtaacaatttactcaaactgcagatagggacaattatgtacttacgccgtaattatttgatttttgtgtcagctcttttg |
229 |
Q |
| |
|
|||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49996430 |
cacattgtcaaactatgtacgtaacaatt-actcaaactgcagatagggacaattatgtacttacgccgtaattatttgatttttgtgtcagctcttttg |
49996528 |
T |
 |
| Q |
230 |
ctttcctttgcttct |
244 |
Q |
| |
|
||||| ||||||||| |
|
|
| T |
49996529 |
ctttcttttgcttct |
49996543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 49996278 - 49996366
Alignment:
| Q |
1 |
tgaggaatgcattttaggtaatataaactgcatttgggaattaacatggtgacctccactagaacaaccagtctgtaagattgtccaac |
89 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49996278 |
tgaggaatgcattttaggtaatataaactgcatttgggaattaacatggtgacctccactagaacaaccagtctgtaagattgtccaac |
49996366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University