View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11446_low_73 (Length: 216)
Name: NF11446_low_73
Description: NF11446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11446_low_73 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 8 - 191
Target Start/End: Original strand, 18071019 - 18071202
Alignment:
| Q |
8 |
agaagcaaagggttaaaaatgaacatgcaatgaagattgaagggattgagaatgactagtgtgcacgttaaaactgtaatgactaatttaatgtcagctg |
107 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18071019 |
agaaacaaggggttaaaaatgaacatgcaatgaagattgaagggattgagaatcactagtgtgcacgttaaaactgtaatgactaatttaatgtcagctg |
18071118 |
T |
 |
| Q |
108 |
ttgatttgaatcggatggttattaatttttcttctcatctctcgaaataaatattgctcacactttatatgctttatatatata |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18071119 |
ttgatttgaatcggatggttattaatttttcttctcatctctcgaaataaatattgctcacactttatatgctttatatatata |
18071202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University