View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11447_high_23 (Length: 251)
Name: NF11447_high_23
Description: NF11447
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11447_high_23 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 61; Significance: 3e-26; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 144 - 208
Target Start/End: Complemental strand, 26966372 - 26966308
Alignment:
| Q |
144 |
aaatgtcattatcattgtattgcacaatagataaacatgtcatcaggaggaactaacccacccaa |
208 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26966372 |
aaatgttattatcattgtattgcacaatagataaacatgtcatcaggaggaactaacccacccaa |
26966308 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 74
Target Start/End: Complemental strand, 26966525 - 26966451
Alignment:
| Q |
1 |
atctgttatttgaattgggatgcccaaaacctactactgtcatctatctatcttttt-aaatcaaagttatgact |
74 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||| |||||||| ||||||||||||||||| |
|
|
| T |
26966525 |
atctgttatttgaattgggatgcccaaaacctactactgtgatctatccatctttttaaaatcaaagttatgact |
26966451 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University