View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11447_high_8 (Length: 535)
Name: NF11447_high_8
Description: NF11447
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11447_high_8 |
 |  |
|
| [»] scaffold0002 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0002 (Bit Score: 445; Significance: 0; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 445; E-Value: 0
Query Start/End: Original strand, 18 - 527
Target Start/End: Complemental strand, 373457 - 372946
Alignment:
| Q |
18 |
ataaactcacagatgaactcgtcatcaccatcactgaaaaagttgctgctttcaaagtccaagatcttttgaacttcagcatgacgtccaaatgtcatcg |
117 |
Q |
| |
|
||||||||||| |||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
373457 |
ataaactcacaaatgaactcctcatcaccattactgaaaaagttgctgctttcaaagtccaagatcttttgaacttcagcatgacgtccaaatgtcatcg |
373358 |
T |
 |
| Q |
118 |
ccaattttccaataagaaggtggcatttagagcgctaagtcgagactttctatggtacattgttgatcccctaccgtgtgcagcaaaaagccggtttatg |
217 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
373357 |
ccaattttccaataagaaggtggtgtttagagcgctaagtcgagactttctatggtacattgttgatcccctaccgtgcgcatcaaaaagccggtttatg |
373258 |
T |
 |
| Q |
218 |
tagaggttgtcccaaattggtcatgcatccatattgtggcgttggctacctttatgcttcaacaaatttggcctaacctggaagagatcaaactgattct |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
373257 |
tagaggttgtcccaaattggtcatgcatccatactgtggcgttggctacatttatgcttcaacaaattcggcctaacctggaagagatcaaactgattct |
373158 |
T |
 |
| Q |
318 |
ggcaaaagggatgaaacatggttccaatagggccaaataaattaatcacattctggaagtatacgctagcgaagggttttctgagaacgaggttatttcc |
417 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
373157 |
ggaaaaagggatgaaacatggttccaatagggccaaatacattaatctcattctggaagtatacgctagcgaagggttttctgagaacgaggttatttcc |
373058 |
T |
 |
| Q |
418 |
gcctttcgggacctctttgaatgacgtcaactcgccaactgcagggatactatcttgaatacggtgggtccacatttttc--attgaatgttctcttctt |
515 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
373057 |
gcctttcgggacctctttgaacgacgtcaactcgccaactgcagggatactatcttgaatacggtgggtccacatttttcatattgaatgttctcttctt |
372958 |
T |
 |
| Q |
516 |
taggcctatgct |
527 |
Q |
| |
|
|||||||||||| |
|
|
| T |
372957 |
taggcctatgct |
372946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 102; Significance: 2e-50; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 102; E-Value: 2e-50
Query Start/End: Original strand, 41 - 293
Target Start/End: Complemental strand, 19919422 - 19919169
Alignment:
| Q |
41 |
atcaccatcactgaaaaagttgctgctttcaaagtccaagatcttttgaacttcagcatgacgtccaaatgtcatcgccaattttccaataagaaggtgg |
140 |
Q |
| |
|
||||||||||||||||| |||||||||||| |||||| ||||||| ||||||||||||||||||||||| ||| | ||||| |||||||||| ||| |
|
|
| T |
19919422 |
atcaccatcactgaaaaggttgctgctttcggagtccaggatctttagaacttcagcatgacgtccaaataccattggaaatttgccaataagaaagtga |
19919323 |
T |
 |
| Q |
141 |
catttagagcgctaagtcgagactttctatggtacattgttgatcccctaccgtgtgcagcaaaaagccggtttatgtagaggttgtcccaaattggtca |
240 |
Q |
| |
|
| || |||||||||| | || | | |||||||||||| ||||||||| ||||||||||||| ||| ||||||||||| ||||||| || ||| |||||| |
|
|
| T |
19919322 |
cgttcagagcgctaaatagaaaatgtctatggtacatcgttgatcccttaccgtgtgcagcgaaacgccggtttatgcagaggttatctaaaagtggtca |
19919223 |
T |
 |
| Q |
241 |
tgcatc-catattgtggcgttggctacctttatgcttcaacaaatttggcctaa |
293 |
Q |
| |
|
|||||| ||| | |||| ||||||||||||||||| || |||||| ||||||| |
|
|
| T |
19919222 |
tgcatcatatagtctggctttggctacctttatgctccagcaaattcggcctaa |
19919169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 382 - 475
Target Start/End: Complemental strand, 19919099 - 19919006
Alignment:
| Q |
382 |
gctagcgaagggttttctgagaacgaggttatttccgcctttcgggacctctttgaatgacgtcaactcgccaactgcagggatactatcttga |
475 |
Q |
| |
|
||||||||||||||||||||||||| |||| |||| ||||||| |||||||| | |||||||||||||||||||||||||| |||| |||| |
|
|
| T |
19919099 |
gctagcgaagggttttctgagaacggggttctttcttcctttcgaaacctctttaaccgacgtcaactcgccaactgcagggatgctattttga |
19919006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University