View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11447_low_15 (Length: 386)
Name: NF11447_low_15
Description: NF11447
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11447_low_15 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 290; Significance: 1e-163; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 10 - 373
Target Start/End: Complemental strand, 13202545 - 13202181
Alignment:
| Q |
10 |
gcagagacctctaaatctaaaactgttatatttctgtcgaattacaaccggggactgaaatttagaactaaatctaagaaataacatcatcacttgttct |
109 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
13202545 |
gcagagacctctaaatctaaagctgttatatttctgtcgaattacaaccggggactgaaatttagaactaaatctaagaa-taacatcatcacttgttct |
13202447 |
T |
|
| Q |
110 |
gtttgatgcagaaaaacagtgcagttgctggagcaatcaccggggctacccttgcacttacattggaagactccacacatgaacatgttgttcaatgtgc |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13202446 |
gtttgatgcagaaaaacagtgcagttgctggagcaatcaccggggctacccttgcacttacattggaagactccacacatgaacatgttgttcaatgtgc |
13202347 |
T |
|
| Q |
210 |
tatcactggagctgcaatctccactgttgcgaatcttctcaaagggattttctaaatggatactctgtctattgatatttgcttttactaaatc--nnnn |
307 |
Q |
| |
|
||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
13202346 |
tatcactggagctgcaatctcaactgttgcaaatcttctcaaagggattttctaaatgggtactctgtctatggatatttgcttttactaaatctttttt |
13202247 |
T |
|
| Q |
308 |
nnncttttggattgtaaaagttccttatacatatttaagatggacttgtaagagtttccttttgaa |
373 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
13202246 |
tttttttttaattgtaaaagttccttatacatatttaagatggacttgtaagaatttccttttgaa |
13202181 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 116 - 149
Target Start/End: Original strand, 50326220 - 50326253
Alignment:
| Q |
116 |
tgcagaaaaacagtgcagttgctggagcaatcac |
149 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |
|
|
| T |
50326220 |
tgcagaaaaatagtgcagttgctggagcaatcac |
50326253 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University