View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11447_low_16 (Length: 360)
Name: NF11447_low_16
Description: NF11447
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11447_low_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 70 - 350
Target Start/End: Original strand, 20120172 - 20120452
Alignment:
| Q |
70 |
agttccgattgcggtgtatggtattcagcattacgtttcaatgttaggttcgttgattcttattccacttgttattgttcccgccatgggaggttctcac |
169 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
20120172 |
agttccgattgcggtgtatggtattcagcattacgtttcaatgttaggttcgttgattcttattccacttgttattgttcctgccatgggaggttctcac |
20120271 |
T |
 |
| Q |
170 |
gtgagtgattttcgagcttttttcgtgttatgtttctcttttatacgatgaagctgttgtgctgttgtctaatgtgttaatgaatatgcaggaggaaact |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20120272 |
gtgagtgattttcgagcttttttcgtgttatgtttctcttttatacgatgaagctgttatgctgttgtctaatgtgttaatgaatatgcaggaggaaact |
20120371 |
T |
 |
| Q |
270 |
tctaatgtggtatcaacagtgttgttcgtttcggggttgactactctgttgcatattagttttgggtcgagattgcctttg |
350 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20120372 |
tctaatgtggtatcaacagtgttgttcgtttcggggttgactactctgttgcatattagttttgggtcgagattgcctttg |
20120452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 63; Significance: 3e-27; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 70 - 180
Target Start/End: Complemental strand, 36036134 - 36036024
Alignment:
| Q |
70 |
agttccgattgcggtgtatggtattcagcattacgtttcaatgttaggttcgttgattcttattccacttgttattgttcccgccatgggaggttctcac |
169 |
Q |
| |
|
|||||| |||| |||||||||||||||||||| ||||| || |||||||| |||||||||||||||||||| |||||||| || |||||||||||||| |
|
|
| T |
36036134 |
agttcccattggcgtgtatggtattcagcattatgtttctatattaggttcattgattcttattccacttgtcattgttcctgctatgggaggttctcat |
36036035 |
T |
 |
| Q |
170 |
gtgagtgattt |
180 |
Q |
| |
|
|||||| |||| |
|
|
| T |
36036034 |
gtgagtcattt |
36036024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University