View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11447_low_24 (Length: 250)
Name: NF11447_low_24
Description: NF11447
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11447_low_24 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 11 - 246
Target Start/End: Original strand, 33976191 - 33976415
Alignment:
| Q |
11 |
caaaggttgaagaggaataatggaagggttatttgttttctaattagtactgcatcaatagtatataatgtcatacgtattttactactacaatataaaa |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||| |||||| |
|
|
| T |
33976191 |
caaaggttgaagaggaataatggaagggttatttgttttctaattagtactgcatcaatagtatataatgtcatac------------tccaaaataaaa |
33976278 |
T |
|
| Q |
111 |
tagta---tttctcatgcaaaatgcaatgcaaaatatattggccttcttctcaaagattttaggtacagagtacaaacggatggtacatgattgtatatt |
207 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33976279 |
tagtagtatttctcatgcaaaatgcaatgcaaaatat--tggccttcttctcaaagattttaggtacagagtacaaacggatggtacatgattgtatatt |
33976376 |
T |
|
| Q |
208 |
gatgcacttttaagaatctgatcctagacacgtgctcaa |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33976377 |
gatgcacttttaagaatctgatcctagacacgtgctcaa |
33976415 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University