View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11447_low_25 (Length: 239)
Name: NF11447_low_25
Description: NF11447
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11447_low_25 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 1 - 187
Target Start/End: Complemental strand, 28581523 - 28581337
Alignment:
| Q |
1 |
actagtatgacagtcatcaaagtagattttattcatgcagttccaaataatatagaaaatattagtaatagcagatagaataagtttcttcacttgagag |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28581523 |
actagtatgacaatcatcaaagtagattttattcatgcagttccaaataatatagaaaatattagtaatagcagatagaataagtttcttcacttgagag |
28581424 |
T |
 |
| Q |
101 |
ctccaattttaaatgatgatagagagaaactgagaattggagatgaataatgaattgcattgtatagacacttttgtttgtgggtta |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28581423 |
ctccaattttaaatgatgatagagagaaactgagaattcgagatgaataatgaattgcattgtatagacacttttgtttgtgggtta |
28581337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University