View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11448_high_10 (Length: 359)
Name: NF11448_high_10
Description: NF11448
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11448_high_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 1 - 352
Target Start/End: Complemental strand, 3163226 - 3162879
Alignment:
| Q |
1 |
tatccatggagctcgagttcagactcgagctacccctcttctatgcattaannnnnnnnnnnnnnnagagtttcgtagataaaaattttagtcaaaaaa- |
99 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| ||||||||||||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
3163226 |
tatccatggagctcgagttcatactcgagctacccct-ttctatgcattaagtgtgtgtgtg----agagtttcgtagataaaaaatttagtcaaaaaaa |
3163132 |
T |
 |
| Q |
100 |
gacatgcttaccacgggtaactctttgcagaagatgaaatatcttagtctagcaaatatatctaacaaaaaatggccaccactaatatgacaatgaacat |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3163131 |
gacatgcttaccacgggtaactctttgcagaagatgaaatatcttagtctagcaaatatatctaacaaaaaatggccaccactaatatgacaatgaacat |
3163032 |
T |
 |
| Q |
200 |
ggagagacatctttcccttcaccttcttccactgcgccacaacttcatccctttgcaatctattataccatccctgcaactgcaattgaattcccatgtt |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3163031 |
ggagagacatctttcccttcaccttcttccactgcgccacaacttcatccctttgcaatctattataccatccctgcaactgcaattgaattcccatgtt |
3162932 |
T |
 |
| Q |
300 |
tgtatacttttttattcctaaaattcaatattcattattttcttgtgtctgtg |
352 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3162931 |
tgtatacttttttattcctaaaattcaatattcattattttcttgtgtgtgtg |
3162879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University