View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11448_low_14 (Length: 251)
Name: NF11448_low_14
Description: NF11448
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11448_low_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 191; Significance: 1e-104; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 13 - 231
Target Start/End: Original strand, 40481665 - 40481878
Alignment:
| Q |
13 |
tacttacctatgtttgattgctgaaaccttaaccttggtttccccctttttaaggtagcttggtttagaaatttgtgcacaaaaatagtagtgctgccac |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40481665 |
tacttacctatgtttgattgctgaaaccttaatcttggtttccccctttttaaggtagcttggtttagaaatttgtgcacaaaaatagtagtgctgccac |
40481764 |
T |
 |
| Q |
113 |
taaccagttaattgtatttccacatttgccccagaaagtgtcaatatatacagtaataattacttagggaaattattgcaagctagctgccatattgctt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
40481765 |
taaccagttaattgtatttccacatttgccccagaaagtgtcaatata-----taataattacttagggaaattattacaagctagctgccatattgctt |
40481859 |
T |
 |
| Q |
213 |
tgtaaaagccttgccgtat |
231 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
40481860 |
tgtaaaagccttgccgtat |
40481878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 88 - 162
Target Start/End: Original strand, 40492405 - 40492480
Alignment:
| Q |
88 |
tgcacaaaaatagta-gtgctgccactaaccagttaattgtatttccacatttgccccagaaagtgtcaatatata |
162 |
Q |
| |
|
||||||||||||||| || ||| |||||||| || ||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
40492405 |
tgcacaaaaatagtaagtagtgctactaaccactttattgtatttccacatttaccccagaaagtgtcaatatata |
40492480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 38
Target Start/End: Original strand, 40481599 - 40481636
Alignment:
| Q |
1 |
acattcaggtattacttacctatgtttgattgctgaaa |
38 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
40481599 |
acattcaggtattacttacctatgattgattgctgaaa |
40481636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 165 - 205
Target Start/End: Complemental strand, 20145045 - 20145005
Alignment:
| Q |
165 |
gtaataattacttagggaaattattgcaagctagctgccat |
205 |
Q |
| |
|
|||| ||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
20145045 |
gtaaaaattactgagggaaattattacaagctagctgccat |
20145005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University