View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1144_high_21 (Length: 316)
Name: NF1144_high_21
Description: NF1144
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1144_high_21 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 96 - 299
Target Start/End: Original strand, 43823205 - 43823408
Alignment:
| Q |
96 |
atatatgatttgtatgacttcaaatctctgtatagactgacccaacacaataattgttactacatgggggatttgaacatgaaacctaaagagaagcaca |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43823205 |
atatatgatttgtatgacttcaaatctctgtatagactgacccaacacaataattgttaccacatgggggatttgaacatgaaacctaaagagaagcaca |
43823304 |
T |
|
| Q |
196 |
ctacaagtcctgggttcccaacccaatcaaaccaggacggaaaaaggaagaaacataaacaaatagagtagaaggctgaccttcatgaccagtgaatgta |
295 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
43823305 |
ctacaagtcctaggttcccaacccaatcaaaccaggacggaaaagggaaaaaacataaacaaatagagtagaaggcagaccttcatgaccggtgaatgta |
43823404 |
T |
|
| Q |
296 |
tgca |
299 |
Q |
| |
|
|||| |
|
|
| T |
43823405 |
tgca |
43823408 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University