View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1144_high_38 (Length: 212)
Name: NF1144_high_38
Description: NF1144
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1144_high_38 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 1 - 125
Target Start/End: Complemental strand, 5470282 - 5470160
Alignment:
| Q |
1 |
ttttataaaaaatgtttgacgttaccaccacacagactggaagtggtccagcctttcacacgtgaagacgctcctccctgctaatgctattttattcacg |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5470282 |
ttttataaaaaatgtttgatgttaccaccaca--gactggaagtggtccagcctttcacacgtgaagacgctcctccctgctaatgctattttattcacg |
5470185 |
T |
 |
| Q |
101 |
tgtgttatcatacatccatcaattc |
125 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
5470184 |
tgtgttatcatacatccatcaattc |
5470160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University