View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1144_low_30 (Length: 325)
Name: NF1144_low_30
Description: NF1144
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1144_low_30 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 133; Significance: 4e-69; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 133; E-Value: 4e-69
Query Start/End: Original strand, 78 - 229
Target Start/End: Complemental strand, 3590418 - 3590266
Alignment:
| Q |
78 |
caaaggaatcgatccttgaaaaa-gatgaagtaaactcaataagtgacttccaaagtccacattcaagctgagaaggagatctcatcacctattatagct |
176 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3590418 |
caaaggaatcgatccttgaaaaaagatgaagtaaactcaataagtgacttccaaagtccacattcaagctgagaaggagatctcatcacctattatagct |
3590319 |
T |
|
| Q |
177 |
gaatgagtgttagctgcttctttatcgatggtactgaagagtgcgaaagttta |
229 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
3590318 |
gaatgagtgttagctgcttcttttccgatagtactgaagagtgcgaaagttta |
3590266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University