View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1144_low_32 (Length: 316)
Name: NF1144_low_32
Description: NF1144
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1144_low_32 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 94; Significance: 7e-46; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 94; E-Value: 7e-46
Query Start/End: Original strand, 85 - 223
Target Start/End: Complemental strand, 31824512 - 31824374
Alignment:
| Q |
85 |
tattgaatgataaaattgagatcatcgtatnnnnnnnttaatttgtgactgatacgcaatagaagaaatatacacagtttccctatgatgaggattgttt |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||| || |||| ||||||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
31824512 |
tattgaatgataaaattgagatcatcgtataaaaaaattaatttgtgcctaatacagaatagaagaaatatacacagtttccctctaatgaggattgttt |
31824413 |
T |
|
| Q |
185 |
ttcaattgatcttgagagacttcttcaattgatatacct |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31824412 |
ttcaattgatcttgagagacttcttcaattgatatacct |
31824374 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 151 - 212
Target Start/End: Original strand, 43326835 - 43326896
Alignment:
| Q |
151 |
aatatacacagtttccctatgatgaggattgtttttcaattgatcttgagagacttcttcaa |
212 |
Q |
| |
|
|||||||||| ||||| ||||||||||||| || | ||| |||||| |||| |||||||||| |
|
|
| T |
43326835 |
aatatacacaatttccttatgatgaggatttttatgcaaatgatctagagatacttcttcaa |
43326896 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 151 - 213
Target Start/End: Original strand, 42161465 - 42161527
Alignment:
| Q |
151 |
aatatacacagtttccctatgatgaggattgtttttcaattgatcttgagagacttcttcaat |
213 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42161465 |
aatatacacagttttcctttgatgaggattgtttttcaattgatcttgagagacttcttcaat |
42161527 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 151 - 213
Target Start/End: Original strand, 40536762 - 40536824
Alignment:
| Q |
151 |
aatatacacagtttccctatgatgaggattgtttttcaattgatcttgagagacttcttcaat |
213 |
Q |
| |
|
|||||||||| ||||| ||||||||||||| || | ||| |||||||||| ||||||||||| |
|
|
| T |
40536762 |
aatatacacaatttccttatgatgaggatttttctgcaaatgatcttgagcaacttcttcaat |
40536824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 153 - 209
Target Start/End: Complemental strand, 10152329 - 10152273
Alignment:
| Q |
153 |
tatacacagtttccctatgatgaggattgtttttcaattgatcttgagagacttctt |
209 |
Q |
| |
|
||||||| ||||| || |||||| |||||||| |||| |||| |||||||||||||| |
|
|
| T |
10152329 |
tatacaccgtttctctttgatgatgattgtttatcaaatgatattgagagacttctt |
10152273 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University