View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1144_low_34 (Length: 315)
Name: NF1144_low_34
Description: NF1144
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1144_low_34 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 105 - 241
Target Start/End: Complemental strand, 40541235 - 40541097
Alignment:
| Q |
105 |
aaaacaataaattttgaatagttactata--atgttgaaaatgaaatgtgcaaaaatatcaagcctctagtcaaaatgaacactaattaccaacaaaaag |
202 |
Q |
| |
|
|||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40541235 |
aaaaaaataaattttgaatagttactatataatgttgaaaatgaaatgtgcaaaaatatcaagcctctagtcaaaatgaacactaattaccaacaaaaag |
40541136 |
T |
 |
| Q |
203 |
aaaaatgaacactaattaaacattcagctgcctttgttt |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
40541135 |
aaaaatgaacactaattaaacattcagctgcttttgttt |
40541097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University