View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1144_low_51 (Length: 242)
Name: NF1144_low_51
Description: NF1144
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1144_low_51 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 106; Significance: 4e-53; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 122 - 231
Target Start/End: Complemental strand, 35158615 - 35158506
Alignment:
| Q |
122 |
cttcttatctttggagcatgcatcacgtcctcgagaaacaatttctttctggatgtgaagtacaacttcacatctcctatgccgacaactttagcagagg |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35158615 |
cttcttatctttggagcatgcatcacgtcctcgagaaacaatttttttctggatgtgaagtacaacttcacatctcctatgccgacaactttagcagagg |
35158516 |
T |
 |
| Q |
222 |
tgtatatttt |
231 |
Q |
| |
|
|||||||||| |
|
|
| T |
35158515 |
tgtatatttt |
35158506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 21 - 100
Target Start/End: Complemental strand, 35158954 - 35158875
Alignment:
| Q |
21 |
attaagcatgattgcaacaactaacttagtaaagatattattctttcttctaactttattgttcattttaagagaatagg |
100 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35158954 |
attaagcatgattgcaacaactaacttggtaaagatattattctttcttctaactttattgttcattttaagagaatagg |
35158875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.00000000002; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 123 - 198
Target Start/End: Complemental strand, 12113887 - 12113812
Alignment:
| Q |
123 |
ttcttatctttggagcatgcatcacgtcctcgagaaacaatttctttctggatgtgaagtacaacttcacatctcc |
198 |
Q |
| |
|
||||||| |||||||||||||| ||||||| ||||| | ||||||| ||||||||| |||||||||| |||||| |
|
|
| T |
12113887 |
ttcttatttttggagcatgcattacgtcctagagaataattttcttttcggatgtgaattacaacttcatatctcc |
12113812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 123 - 158
Target Start/End: Original strand, 20506876 - 20506911
Alignment:
| Q |
123 |
ttcttatctttggagcatgcatcacgtcctcgagaa |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| |
|
|
| T |
20506876 |
ttcttatctttggagcatgcatcacgtcctagagaa |
20506911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University