View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1144_low_52 (Length: 235)
Name: NF1144_low_52
Description: NF1144
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1144_low_52 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 18 - 98
Target Start/End: Complemental strand, 35967279 - 35967199
Alignment:
| Q |
18 |
agtttgtgatgtattttgtgtcgctatgttgttttcttgaacttggttgatggatactttttaaatcctttccttacccat |
98 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||||||||||||||||||||||||| ||||| |||| ||||||||||||| |
|
|
| T |
35967279 |
agtttgtgatgtattttgtgtcactatcttgttttcttgaacttggttgatggatattttttgaatcatttccttacccat |
35967199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University