View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11452_high_7 (Length: 257)
Name: NF11452_high_7
Description: NF11452
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11452_high_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 1 - 249
Target Start/End: Complemental strand, 45175960 - 45175712
Alignment:
| Q |
1 |
tacctgaatataattcatccaatttaattcaatttgcaatattcagaatgagacatgaagataactaaaagggacagttttggaattgtagtatacaagt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45175960 |
tacctgaatataattcatccaatttaattcaatttgcaatattcagaatgagacatgaagataactaaaagggacagttttggaattgtagtatacaagt |
45175861 |
T |
 |
| Q |
101 |
ggaccccacatgaaatgaaaatactagtaatgtactataccctttcagcaaggctgtggctatcagtggcctgaccccttcttgctcggacgtggatata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45175860 |
ggaccccacatgaaatgaaaatactagtaatgtactgtaccctttcagcaaggctgtggctatcagtggcctgaccccttcttgctcggacgtggatata |
45175761 |
T |
 |
| Q |
201 |
gccagttgggggctcatccaaacactttctctgatcttttttctctgct |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45175760 |
gccagttgggggctcatccaaacactttctctgatcttttttctctgct |
45175712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 137 - 209
Target Start/End: Complemental strand, 40311508 - 40311436
Alignment:
| Q |
137 |
ataccctttcagcaaggctgtggctatcagtggcctgaccccttcttgctcggacgtggatatagccagttgg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||| || ||||||||||||||||||| ||| |||||||| |||||||| |
|
|
| T |
40311508 |
ataccctttcagcaaggctgtggctatctgttgcctgaccccttcttgctctgacatggatataaccagttgg |
40311436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 137 - 197
Target Start/End: Original strand, 16270388 - 16270448
Alignment:
| Q |
137 |
ataccctttcagcaaggctgtggctatcagtggcctgaccccttcttgctcggacgtggat |
197 |
Q |
| |
|
|||| ||||| ||||| || ||||||||||| || ||||||||||| |||||||| ||||| |
|
|
| T |
16270388 |
atactctttctgcaagactatggctatcagtagcttgaccccttctagctcggacatggat |
16270448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University