View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11452_low_8 (Length: 243)
Name: NF11452_low_8
Description: NF11452
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11452_low_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 196; Significance: 1e-107; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 43165202 - 43164958
Alignment:
| Q |
1 |
tactgagaagcttaaaatgatgtgatcaaatttaacgtcttaaaccccttcattgatgatcacaatttttgcacgtcttttagtctcatagaagtgtgtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43165202 |
tactgagaagcttaaaatgatgtgatcaaatttaacgtcttaaaccccttcattgatgatcacaatttttgcacgtcttttagtctcatagaagtgtgtt |
43165103 |
T |
 |
| Q |
101 |
tgagaagtgtccaaagagtgttgtaggggtgtcgaatcaaagaaaa------------tcgaggaacttgtctgaatgtcagtcaagtgccttacgggtg |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
43165102 |
tgagaagtgtccaaagagtgttgtaggggtgtcgaatcaaagaaaaatatatttttttttgaggaacttgtctgaatgtcagtcaagttccttacgggtg |
43165003 |
T |
 |
| Q |
189 |
tcacacgccaagtgtgttgggcacacctaatcagaggtgtctgtg |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43165002 |
tcacacgccaagtgtgttgggcacacctaatcagaggtgtctgtg |
43164958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 8 - 57
Target Start/End: Original strand, 43222578 - 43222627
Alignment:
| Q |
8 |
aagcttaaaatgatgtgatcaaatttaacgtcttaaaccccttcattgat |
57 |
Q |
| |
|
||||| |||||||||| ||||||||||| ||||| || |||||||||||| |
|
|
| T |
43222578 |
aagctaaaaatgatgtaatcaaatttaatgtctttaagcccttcattgat |
43222627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University