View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11453A_high_19 (Length: 337)

Name: NF11453A_high_19
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11453A_high_19
NF11453A_high_19
[»] chr3 (1 HSPs)
chr3 (107-185)||(51727903-51727981)


Alignment Details
Target: chr3 (Bit Score: 75; Significance: 2e-34; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 107 - 185
Target Start/End: Original strand, 51727903 - 51727981
Alignment:
107 ttgaaagctcgtgaacaatgtatcttcgagtagatatgtatttttactatttttgacaaagctcgtgaacagcatttgt 185  Q
    |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
51727903 ttgaaagctcgtgaacaatgtatcttggagtagatatgtatttttactatttttgacaaagctcgtgaacagcatttgt 51727981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University