View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453A_high_32 (Length: 224)
Name: NF11453A_high_32
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453A_high_32 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 5 - 224
Target Start/End: Complemental strand, 15827796 - 15827576
Alignment:
| Q |
5 |
agtttggtgttctgtttatattgtgttttgtttgctgttttcattataacttagttgttagttgnnnnnnnnn-tcactcctagttatggattgctattt |
103 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
15827796 |
agttttgtgttctgtttatattgtgttttgtttgctgttttcattataacttagttgttagttggaaaaaaaaatcactcctagttatggattgctattt |
15827697 |
T |
|
| Q |
104 |
taactatttgaaagcaagacctttttagccacaaattttattacgatttctatggggttgagaatacaataggtcacaatgnnnnnnntttcatgtccat |
203 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
15827696 |
taactatttgaaagcaagaccttttcagccacaaattttattacgatttctatggggttgagaatacaataggtcacaatgaaacaaatttcatgtccat |
15827597 |
T |
|
| Q |
204 |
caaaatacaaaatgttggtta |
224 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
15827596 |
caaaatacaaaatgttggtta |
15827576 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University