View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11453A_high_33 (Length: 224)

Name: NF11453A_high_33
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11453A_high_33
NF11453A_high_33
[»] chr6 (2 HSPs)
chr6 (26-149)||(7345297-7345420)
chr6 (141-215)||(7345038-7345112)


Alignment Details
Target: chr6 (Bit Score: 100; Significance: 1e-49; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 26 - 149
Target Start/End: Complemental strand, 7345420 - 7345297
Alignment:
26 atcttcgtagtaatctcttgtgacatgaacaattgtctttttattttacgttaaccctcctatttgcagaaaaggaccttgataagttggaattcgaccg 125  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||| || |  ||    
7345420 atcttcgtagtaatctcttgtgacatgaacaattgtctttttattttacgttaaccctcctatttgcagagaaggaccttgataatttggagtttggtcg 7345321  T
126 tggatcaaaatagtccgataaaaa 149  Q
    ||||||||||||||||||||||||    
7345320 tggatcaaaatagtccgataaaaa 7345297  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 141 - 215
Target Start/End: Complemental strand, 7345112 - 7345038
Alignment:
141 cgataaaaaatgataatctgatcaaaaattgtttcgtctaagaatcaaacctactttctttcaatcaattcgtct 215  Q
    |||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||| ||||||||    
7345112 cgataaaaaatgataatctgatcaaagattgtttcgtctaggaatcaaacctactttctttcaatcgattcgtct 7345038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University