View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453A_low_117 (Length: 368)
Name: NF11453A_low_117
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453A_low_117 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 307; Significance: 1e-173; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 12 - 364
Target Start/End: Original strand, 47116765 - 47117113
Alignment:
| Q |
12 |
agatggacatcactccaagcttcctcatacccttgttatttcatttccttatgatatctcnnnnnnnctgacattgttttgtttcatcgcttctcaggta |
111 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
47116765 |
agatggacaccactccaagcttcctcatacccttgttatttcatttccttatgatatctctttttttctgacattgttttgtttcatcgcttctcaggta |
47116864 |
T |
|
| Q |
112 |
attacaatagttatattttatcaaagatattcaataaccaatttcttttatatctttagtttcaattcaaggagataaatattcataccttttaacgatc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47116865 |
attacaatagttatattttatcaaagatattcaataaccaatttcttttatatctttagtttcaattcaaggagataaatattcataccttttaacgatc |
47116964 |
T |
|
| Q |
212 |
aaatcacaaagcaaggtaagcaatatcaacgtatcaatgactcgatcgatcaccttttaacgattatttttaatttcttgttttgtagatggataggcgg |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47116965 |
aaatcacaaagcaaggtaagcaatatcaacgtatcaatgac----tcgatcaccttttaacgattatttttaatttcttgttttgtagatggataggcgg |
47117060 |
T |
|
| Q |
312 |
agaatgtatgataggcaacaaagctcaacgggaacgccaacatcaccatcttc |
364 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
47117061 |
agaatgtatgataggcaacaaagctcaacgggaacgccaacatcaccgtcttc |
47117113 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University