View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453A_low_130 (Length: 357)
Name: NF11453A_low_130
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453A_low_130 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 157; Significance: 2e-83; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 201 - 357
Target Start/End: Complemental strand, 41785983 - 41785827
Alignment:
| Q |
201 |
aagctggctcactgcatttgtcaagttcaatttctctcctccttctttgctcactgtggcttctaaattccatactttgtctcttaacaacaattcctgc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41785983 |
aagctggctcactgcatttgtcaagttcaatttctctcctccttctttgctcactgtggcttctaaattccatactttgtctcttaacaacaattcctgc |
41785884 |
T |
 |
| Q |
301 |
tcttctttttcgctcagtagcgttgtaagacaatccacattttccttcaattgtttc |
357 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41785883 |
tcttctttttcgctcagtagcgttgtaagacaatccacattttccttcaattgtttc |
41785827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 132; E-Value: 2e-68
Query Start/End: Original strand, 23 - 158
Target Start/End: Complemental strand, 41786161 - 41786026
Alignment:
| Q |
23 |
atgtcttcttattaactctcatacttgcgaccaaattcattagatagttacaccggtcgcgatgaaactcaacaaccaaacaaagctgtcttattgcttc |
122 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41786161 |
atgtcttcttattaactctcatacttgtgaccaaattcattagatagttacaccggtcgcgatgaaactcaacaaccaaacaaagctgtcttattgcttc |
41786062 |
T |
 |
| Q |
123 |
cctcttcttctccccaaggctatccaaatcctcatc |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
41786061 |
cctcttcttctccccaaggctatccaaatcctcatc |
41786026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University