View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453A_low_135 (Length: 356)
Name: NF11453A_low_135
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453A_low_135 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 298; Significance: 1e-167; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 6 - 346
Target Start/End: Complemental strand, 41656646 - 41656309
Alignment:
| Q |
6 |
aatatactgtaaggttgtcgttcctggaggcttcttcacttagttcacagcaacctcagctgaaaggaaatttgaatgaagtacatcctgaccagaaact |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41656646 |
aatatactgtaaggttgtcgttcctggaggcttcttcacttagttcacagcaacctcagctgaaaggaaatttgaatgaagtacatcctgaccagaaact |
41656547 |
T |
|
| Q |
106 |
ttagctttagagttcttcagcacttggaaagcttcttccaccttggcagaaagagactctggtgattcaatgagaaccagcaattcagcattgtccatct |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41656546 |
ttagctttagagttcttcagcacttggaaagcttcttccaccttggcagaaagagactctggtgattcaatgagaaccagcaattcagcattgtccatct |
41656447 |
T |
|
| Q |
206 |
ccaaaagcatcccagtaatctttgctgctaggttaggctgctcaagatagcataataaatatactttttaagaattcaaaagcccaatcttatatacccn |
305 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41656446 |
ccaaaagcatcccagtaatctttgctgctaggttaggctgctcaacatagcataataaatatactttttaagaattcaaaagcccaatcttatataccc- |
41656348 |
T |
|
| Q |
306 |
nnnnnnnnngagaatagtgcaaagttataccttgatattct |
346 |
Q |
| |
|
||||||||||||||||||||||||||| |||| |
|
|
| T |
41656347 |
--aaaaaaagagaatagtgcaaagttataccttgattttct |
41656309 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University