View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453A_low_150 (Length: 347)
Name: NF11453A_low_150
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453A_low_150 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 151; Significance: 7e-80; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 151; E-Value: 7e-80
Query Start/End: Original strand, 118 - 341
Target Start/End: Original strand, 44546958 - 44547176
Alignment:
| Q |
118 |
ataattaatgtggaaagcttggtaatatgcaatcttatatttgtcaannnnnnnnnnnnctaatagtccacattttatctttcttttatgatgtgtatgt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44546958 |
ataattaatgtggaaagcttggtaatatgcaatcttaaatttgtcaatttttcttttttctaatagtccacattttatctttcttttatgatgtgtatgt |
44547057 |
T |
|
| Q |
218 |
actatctattcgaatgccattgcttccagtcagcccatcggtaaccgttggatcgagaccaaatggttcagatcttgatcccatctaacagttagcgatg |
317 |
Q |
| |
|
||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44547058 |
actat----tcgaatgtcattgcttccagtcagcccatcggtaaccgttggatcgagaccaaatggttcagatcttgatcccatctaacagttagcgatg |
44547153 |
T |
|
| Q |
318 |
caccgattgtgtgaatgtcggggg |
341 |
Q |
| |
|
||| ||||||||| |||||||||| |
|
|
| T |
44547154 |
cactgattgtgtg-atgtcggggg |
44547176 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 1 - 53
Target Start/End: Original strand, 44546841 - 44546893
Alignment:
| Q |
1 |
aagaacgatgtgaatgaggaagaaggtgtttcagctgtgaaagctacatttgt |
53 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44546841 |
aagaacgatgtgaatgaggaagaaggtgtttcagctgtgaaagctacatttgt |
44546893 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University