View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11453A_low_170 (Length: 333)
Name: NF11453A_low_170
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11453A_low_170 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 107; Significance: 1e-53; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 24 - 186
Target Start/End: Original strand, 4988388 - 4988550
Alignment:
| Q |
24 |
agtggtctcattatgttaatttaaatctcaaatgtttaaggtggatcaccattgtaggtac-acaatagatatcattatatatataattttaaccattat |
122 |
Q |
| |
|
|||||||||||||||| |||||||| |||||||||||||||||||||| |||||||||||| ||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
4988388 |
agtggtctcattatgtcaatttaaacctcaaatgtttaaggtggatcaacattgtaggtactacaatagatctcattatatatataattttaaccattat |
4988487 |
T |
|
| Q |
123 |
annnnnnnnataaaaaatggggatcattggatatcatgtagatttattatatcttatcgtaaac |
186 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
4988488 |
a-tttttttataaaaaatggggatcattggatatcatgtagatctattatatcttatcgtaaac |
4988550 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 182 - 212
Target Start/End: Original strand, 4991965 - 4991995
Alignment:
| Q |
182 |
taaaccaccaacaattaattttttatttttg |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
4991965 |
taaaccaccaacaattaattttttatttttg |
4991995 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University